flncb

Ensembl ID:
ENSDARG00000018820
ZFIN ID:
ZDB-GENE-041008-175
Description:
Novel protein similar to vertebrate filamin C, gamma (Actin binding protein 280) (FLNC) [Source:UniP
Human Orthologue:
FLNC
Human Description:
filamin C, gamma [Source:HGNC Symbol;Acc:3756]
Mouse Orthologue:
Flnc
Mouse Description:
filamin C, gamma Gene [Source:MGI Symbol;Acc:MGI:95557]

Alleles

There are 9 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa15601 Nonsense Available for shipment Available now
sa12735 Nonsense Available for shipment Available now
sa6929 Essential Splice Site Mutation detected in F1 DNA During 2014
sa20216 Essential Splice Site Mutation detected in F1 DNA During 2014
sa11171 Nonsense Available for shipment Available now
sa5246 Essential Splice Site F2 line generated During 2014
sa11278 Essential Splice Site Available for shipment Available now
sa7556 Missense Mutation detected in F1 DNA During 2014
sa20217 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa15601
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000026492 Nonsense 65 2743 1 48
ENSDART00000134286 None None 2248 None 40
ENSDART00000026492 Nonsense 65 2743 1 48
ENSDART00000134286 None None 2248 None 40
Genomic Location:
Chromosome 4 (position 9129464)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGAACACCTTCACCAGGTGGTGCAACGAACACCTGAAATGCCTCAACAGA[A/T]AGATCCTRGAYCTGCAGAAGGACCTGACCGACGGGCTCAAGCTCATCGGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12735
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000026492 Nonsense 65 2743 1 48
ENSDART00000134286 None None 2248 None 40
ENSDART00000026492 Nonsense 65 2743 1 48
ENSDART00000134286 None None 2248 None 40
Genomic Location:
Chromosome 4 (position 9129464)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGAACACCTTCACCAGGTGGTGCAACGAACACCTGAAATGCCTCAACAGA[A/T]AGATCCTGGAYCTGCAGAAGGACCTGACCGACGGGCTCAAGCTCATCGGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6929
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000026492 Essential Splice Site 127 2743 1 48
ENSDART00000134286 None None 2248 None 40
Genomic Location:
Chromosome 4 (position 9129652)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTGGCGCTGGAGTTTCTGGAAAGGGAACACATCAAACTGGTTTCAATAGG[T/A]AAGTGCGCTTTCCTGGCATACATATGCGCTCAATGCGGTGGCSAACGCAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20216
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000026492 Essential Splice Site 479 2743 8 48
ENSDART00000134286 None None 2248 None 40
Genomic Location:
Chromosome 4 (position 9163938)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CGCCGGCCAGCAAATACCCAGAAGTCCTTTCACTGTGCACATCTCAGAGG[G/T]TGAGACCCATGTCCTCACTTCTGGACTTAATTCCTTTAAGAAATGTATTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11171
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000026492 Nonsense 728 2743 14 48
ENSDART00000134286 Nonsense 247 2248 6 40
Genomic Location:
Chromosome 4 (position 9168177)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTTTTGTCCTTCTTTTATYCAAGGACTCAGAAGGGTTTCCCATCAACATC[C/T]AGATCACAGATWAYGGCGACAGCACATATTTCTGCGTCTATATACCCATC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa5246
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000026492 Essential Splice Site 766 2743 14 48
ENSDART00000134286 Essential Splice Site 285 2248 6 40
Genomic Location:
Chromosome 4 (position 9168294)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTATCATCATCACATGGGGAGAGGTCAACGTTCCCAACAGTCCTTTCAGG[G/A]TGAGAGCTCACTGTCAACAGGCAAATTTCACCYGGYTGATGACATTTTTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11278
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000026492 Essential Splice Site 861 2743 16 48
ENSDART00000134286 Essential Splice Site 375 2248 8 40
Genomic Location:
Chromosome 4 (position 9168955)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CACCCCCTGGTGCTGGACGCTACACMATCATGGTGCTATTTGCAGATCAA[G/A]TAAGGCTCAKTCAATAATRTGATRTGACTCATAAGCAATCTAAAATCTGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa7556
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > T
Consequence:
Missense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000026492 Missense 1287 2743 22 48
ENSDART00000134286 Missense 801 2248 14 40
Genomic Location:
Chromosome 4 (position 9172556)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGTATGTTTTYACAGGGGTGCTCCGAGARGTTACTACRCACTTCRTTGTT[G/T]ACACTCGGGTTCACARCAARATGGGTGGAAACCACATCAAAGTTCGTATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20217
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000026492 Nonsense 1936 2743 35 48
ENSDART00000134286 Nonsense 1449 2248 27 40
Genomic Location:
Chromosome 4 (position 9180477)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAAGATGGCACCTGCACTGTATCCTACCTGCCAACGGCCCCGGGAGACTA[C/A]AACATAATCGTCAAATTTGATGACAAGCACATCGCTGGAAGCCCCTTTAC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/wu2z4k1o