bdnf

Ensembl ID:
ENSDARG00000018817
ZFIN ID:
ZDB-GENE-000412-1
Description:
brain-derived neurotrophic factor [Source:RefSeq peptide;Acc:NP_571670]
Human Orthologue:
BDNF
Human Description:
brain-derived neurotrophic factor [Source:HGNC Symbol;Acc:1033]
Mouse Orthologue:
Bdnf
Mouse Description:
brain derived neurotrophic factor Gene [Source:MGI Symbol;Acc:MGI:88145]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa34104 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa34104
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000014843 Nonsense 133 270 2 2
ENSDART00000075389 Nonsense 141 239 2 2
ENSDART00000131009 Nonsense 133 270 2 2
ENSDART00000132353 Nonsense 161 185 2 2
ENSDART00000144682 Nonsense 133 143 3 3
Genomic Location (Zv9):
Chromosome 7 (position 33260657)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 31654997
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGTGATGATCAGCAACCAAGTGCCTTTGGAGCCGCCGTTACTCTTTCTCT[T/A]GGAGGAATACAAAAACTACCTGGATGCCGCCAACATGTCGATGCGTGTGC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Body mass index: Association analyses of 249,796 individuals reveal 18 new loci associated with body mass index. (View Study)
  • Body mass index: Common variants at CDKAL1 and KLF9 are associated with body mass index in east Asian populations. (View Study)
  • Obesity: Genome wide association study identifies KCNMA1 contributing to human obesity. (View Study)
  • Smoking behavior: Genome-wide meta-analyses identify multiple loci associated with smoking behavior. (View Study)
  • Weight: Genome-wide association yields new sequence variants at seven loci that associate with measures of obesity. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link