esrp2

Ensembl ID:
ENSDARG00000018814
ZFIN ID:
ZDB-GENE-030131-9824
Description:
Epithelial splicing regulatory protein 2 [Source:UniProtKB/Swiss-Prot;Acc:Q7ZVR8]
Human Orthologue:
ESRP2
Human Description:
epithelial splicing regulatory protein 2 [Source:HGNC Symbol;Acc:26152]
Mouse Orthologue:
Esrp2
Mouse Description:
epithelial splicing regulatory protein 2 Gene [Source:MGI Symbol;Acc:MGI:1924661]

Alleles

There are 6 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa7075 Essential Splice Site Mutation detected in F1 DNA During 2014
sa2405 Nonsense Mutation detected in F1 DNA During 2014
sa21001 Splice Site, Nonsense Mutation detected in F1 DNA During 2014
sa18119 Nonsense Available for shipment Available now
sa18517 Nonsense Available for shipment Available now
sa3639 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa7075
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000009698 Essential Splice Site 125 736 4 16
ENSDART00000075089 Essential Splice Site 125 711 4 17
Genomic Location:
Chromosome 7 (position 36259501)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CGGKCCACTTCTTATTCGACAGGTGCTTCACCCTGAGGCTTCTAAAAAGG[T/C]AAATTACCTTCCAAGCTAAAAACGCTTTCCTTCTTGTGTATTTATGCTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa2405
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000009698 Nonsense 303 736 10 16
ENSDART00000075089 Nonsense 303 711 10 17
Genomic Location:
Chromosome 7 (position 36264075)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TAACTCATGCCACTTTGTGNNTTTGTTTCAGGTTTATAAGGCGACCGGGGAG[G/T]AATTCCTGAAGATTGCAGGAGGTRAGACATTTACATGAGGTCTTCAATTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21001
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Splice Site, Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000009698 Splice Site, Nonsense 489 736 12 16
ENSDART00000075089 Splice Site, Nonsense 489 711 12 17
Genomic Location:
Chromosome 7 (position 36265980)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AACACACCATTGACATCAAACCTCATGGAGTGCACATGGTCCTCAACCAG[C/T]AGGTGCCTCAGAAAGGCCTGATGTTTCTCGAAACTTGTCATGGGGTCTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18119
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000009698 Nonsense 579 736 14 16
ENSDART00000075089 Nonsense 579 711 14 17
ENSDART00000009698 Nonsense 579 736 14 16
ENSDART00000075089 Nonsense 579 711 14 17
Genomic Location:
Chromosome 7 (position 36267940)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCTGCGTTTCCTGCGGCTCCAGCTATGCTTCCCACTGAGGCAGCGCTGTA[T/A]CAGCCCCCCCTGCYGGCCACTCCAAGAACTCCACAGGCCYCAACACACAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18517
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000009698 Nonsense 579 736 14 16
ENSDART00000075089 Nonsense 579 711 14 17
ENSDART00000009698 Nonsense 579 736 14 16
ENSDART00000075089 Nonsense 579 711 14 17
Genomic Location:
Chromosome 7 (position 36267940)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCTGCGTTTCCTGCGGCTCCAGCTATGCTTCCCACTGAGGCAGCGCTGTA[T/A]CAGCCCCCCCTGCYGGCCACTCCAAGAACTCCACAGGCCYCAACACACAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa3639
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000009698 None None 736 None 16
ENSDART00000075089 Nonsense 689 711 16 17
Genomic Location:
Chromosome 7 (position 36272940)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTTGTGGACTGACTGTGGCTCATTGTGCTGTAGCTCAATCCTGAAGACTA[C/A]AGCTCCTTGGTTGGAGTGAGTGATCAGGGCCGGAGTTTCATTCAGCCTAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/kydi7tdy