ctsc

Ensembl ID:
ENSDARG00000018806
ZFIN ID:
ZDB-GENE-030619-9
Description:
dipeptidyl peptidase 1 [Source:RefSeq peptide;Acc:NP_999887]
Mouse Orthologue:
Ctsc
Mouse Description:
cathepsin C Gene [Source:MGI Symbol;Acc:MGI:109553]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa4626 Essential Splice Site Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa4626
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000022838 Essential Splice Site 100 455 2 7
Genomic Location:
Chromosome 15 (position 42381824)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGGGCTTCGAGGTGGTGATCAATGAMTACAAATGGTTCGGGTTTTTCAAG[G/T]CAAGTCTGACTGGACAGTTTCCGTCTCAAGTGACACCACATGACTGATCA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/1w3w7bth