efna1b

Ensembl ID:
ENSDARG00000018787
ZFIN ID:
ZDB-GENE-041007-5
Description:
ephrin A1b [Source:RefSeq peptide;Acc:NP_957077]
Human Orthologue:
EFNA1
Human Description:
ephrin-A1 [Source:HGNC Symbol;Acc:3221]
Mouse Orthologue:
Efna1
Mouse Description:
ephrin A1 Gene [Source:MGI Symbol;Acc:MGI:103236]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa42713 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa42713
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000015956 Nonsense 56 229 2 5

The following transcripts of ENSDARG00000018787 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 16 (position 25534150)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 23379825
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACCGTCGATGTACGCATTAATGACTATCTGGACATCATCTGCCCTCACTA[T/A]GCGCATGGCGAGATCGCTTCCCAGGAGGCAGAACGATATGTGCTGTACAT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link