KDM4A (2 of 2)

Ensembl ID:
ENSDARG00000018782
Description:
lysine (K)-specific demethylase 4A [Source:HGNC Symbol;Acc:22978]
Human Orthologue:
KDM4A
Human Description:
lysine (K)-specific demethylase 4A [Source:HGNC Symbol;Acc:22978]
Mouse Orthologue:
Kdm4a
Mouse Description:
lysine (K)-specific demethylase 4A Gene [Source:MGI Symbol;Acc:MGI:2446210]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa40621 Nonsense Mutation detected in F1 DNA During 2018
sa33790 Missense Mutation detected in F1 DNA During 2018
sa45240 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa40621
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000065583 Nonsense 135 1487 3 29
Genomic Location (Zv9):
Chromosome 6 (position 3094054)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 3126822
GRCz11 6 3287117
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAACTGGAGAGAAAATTTTGGAAGAATTTAACATTCAATCCACCATTATA[T/A]GGGGCAGATGTCAGTGGAACCCTCTATGATCCCGTGAGTGATCTGCCATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33790
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > T
Consequence:
Missense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000065583 Missense 406 1487 12 29
Genomic Location (Zv9):
Chromosome 6 (position 3099924)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 3132692
GRCz11 6 3292987
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTCCAAAGCAGAACACGGGGCAGAAGAGGCTCAGATCCAGCACTGACAAT[G/T]AAGCAAAAGACGACAATCAAGTAAAGATAGAAGTGGAGGAGGTTGAGAAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa45240
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000065583 Nonsense 1065 1487 19 29
Genomic Location (Zv9):
Chromosome 6 (position 3105834)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 3138602
GRCz11 6 3298897
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACCCAGCTGTGGCAGAACAGACCGTACAATCCAGATCGAGAGAGAGAGTA[C/A]AACAGAGAGATGGGTCTGCGGCCTCCATACTGCTCCATCTGCATGCTCTT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link