LOC100149107

Ensembl ID:
ENSDARG00000018773
Human Orthologue:
HIVEP2
Human Description:
human immunodeficiency virus type I enhancer binding protein 2 [Source:HGNC Symbol;Acc:4921]
Mouse Orthologue:
Hivep2
Mouse Description:
human immunodeficiency virus type I enhancer binding protein 2 Gene [Source:MGI Symbol;Acc:MGI:13380

Alleles

There are 9 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa17118 Nonsense Available for shipment Available now
sa36300 Nonsense Mutation detected in F1 DNA During 2016
sa6459 Nonsense Mutation detected in F1 DNA During 2016
sa39140 Nonsense Mutation detected in F1 DNA During 2016
sa42860 Nonsense Mutation detected in F1 DNA During 2016
sa36299 Nonsense Mutation detected in F1 DNA During 2016
sa12410 Nonsense Available for shipment Available now
sa4693 Nonsense Mutation detected in F1 DNA During 2016
sa13991 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa17118
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000022010 Nonsense 60 1696 1 7
Genomic Location:
Chromosome 17 (position 6162552)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTATTCCTTGCGGATTCTCATTTAAAACTAAGAGCAACTTATACAAACAC[A/T]GAAAATCTCACACMCATGCTGYGAAAGCAGGATTGGTTTCAGTTTCAGAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36300
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000022010 Nonsense 175 1696 1 7
Genomic Location:
Chromosome 17 (position 6162207)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTCGGGAAATGACGGCACCTGTGGCTATTGCTCAGATAGACCAAATGGTT[G/T]AGTTTTCCACCATCAAGCAAAAACTAGCACTACGGCTATCAGAGAAGAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6459
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000022010 Nonsense 276 1696 1 7
Genomic Location:
Chromosome 17 (position 6161904)
KASP Assay ID:
554-5442.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCATGAYAGACATAAATGAAGCCACATCTAGCTTCATGATTACACTGAAC[A/T]AAGGCATGATGCCTGGTGACACGGACTCCTCCATTCACAGAAGCAAAAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39140
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000022010 Nonsense 331 1696 1 7
Genomic Location:
Chromosome 17 (position 6161738)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AATTCCCAGCTCTGACCTTCTGGAAACAGCATTGGAGAGTAGTGTATTCT[T/A]GCGCAGTAACTCTCTTCCAACCTCATCTAAGTCTAATCTGAATACACCAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42860
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000022010 Nonsense 404 1696 1 7
Genomic Location:
Chromosome 17 (position 6161520)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATGAAGGTCACGCAGAATCAGACTGCTATACTCATTTGGCTTGTAGCTTA[A/T]AATCCGACTTGAAAATTCACAGCATAGATGATTCCAAAATGGCTGCTGAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36299
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000022010 Nonsense 946 1696 1 7
Genomic Location:
Chromosome 17 (position 6159893)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCACAGCCTACAAGCATCACCAGCAAAGCTTAAAACAGGTATACCTCTAT[C/A]ATTAACCTCCAAAACCATTTCAACTACTGAAGCCCCAAGTGGTGGTGCAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12410
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000022010 Nonsense 984 1696 1 7
Genomic Location:
Chromosome 17 (position 6159780)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
YCTCACCTGCAAGYAGCATTGAACTMTTTATTGAGGCAAAGCAGCAAAAA[C/T]GAGTCAAAGAYGAGAACATTTATGGTCAGATTGYTGAAGAGCTTAGTGCW
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa4693
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000022010 Nonsense 1236 1696 3 7
Genomic Location:
Chromosome 17 (position 6158842)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTTGTATAAGWGTTGTTTATTCCTTTCAGGTATAAGTCCAATGAGGAATA[T/A]GTGTATGTAAGGGGCCGTGGTCGGGGAAAGTATATATGTGAAGAGTGTGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13991
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000022010 Essential Splice Site 1324 1696 4 7
Genomic Location:
Chromosome 17 (position 6158504)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTCACCGACAGCTATGGACAATACAGAAGATGCTGGTAGGAGCCTGTTCT[G/A]TAAGAAGCTAGGCATTAGCCTAGCCAAAACAATTTCTGAGCCASTTATAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link