si:dkey-14d8.22

Ensembl ID:
ENSDARG00000018770
ZFIN ID:
ZDB-GENE-041210-148
Description:
Novel protein similar to vertebrate protein deleted in malignant brain tumors 1 [Source:UniProtKB/Tr
Human Orthologues:
AC008735.1, CD5L
Human Descriptions:
CD5 molecule-like [Source:HGNC Symbol;Acc:1690]
Scavenger receptor cysteine-rich domain-containing protein LOC284297 [Source:UniProtKB/Swiss-Prot;Ac
Mouse Orthologues:
A430110N23Rik, Cd5l
Mouse Descriptions:
CD5 antigen-like Gene [Source:MGI Symbol;Acc:MGI:1334419]
RIKEN cDNA A430110N23 gene Gene [Source:MGI Symbol;Acc:MGI:3606211]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa33374 Nonsense Mutation detected in F1 DNA During 2017
sa16960 Nonsense Available for shipment Available now
sa15366 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa33374
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000008037 Nonsense 256 461 4 7
ENSDART00000133352 Nonsense 448 635 5 6
Genomic Location (Zv9):
Chromosome 4 (position 5357160)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 5475341
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TATATTTAGGCCCTATTAGGTTGGCAAATGGCCGTGACTCTTGTTCTGGG[C/T]GAGTGGAGTGGATTCATAATAAGACATGGGGAACAGTGAGTGATGATGGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16960
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000008037 Nonsense 394 461 6 7
ENSDART00000133352 Nonsense 578 635 6 6
ENSDART00000008037 Nonsense 394 461 6 7
ENSDART00000133352 Nonsense 578 635 6 6
Genomic Location (Zv9):
Chromosome 4 (position 5354784)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 5472965
KASP Assay ID:
2259-4441.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAGTGTGTTCCTCGGGCTGGGACRAAAAAGACGCTTCAGTGTTGTGTCAA[C/T]AGCTGGGTTGTGATGATACTGGACAGCCGAAGACATTCGCAAGTCCTTCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15366
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000008037 Nonsense 394 461 6 7
ENSDART00000133352 Nonsense 578 635 6 6
ENSDART00000008037 Nonsense 394 461 6 7
ENSDART00000133352 Nonsense 578 635 6 6
Genomic Location (Zv9):
Chromosome 4 (position 5354784)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 5472965
KASP Assay ID:
2259-4441.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAGTGTGTTCCTCGGGCTGGGACRAAAAAGACGCTTCAGTGTTGTGTCAA[C/T]AGCTGGGTTGTGATGATACTGGACAGCCGAAGACATTCGCAAGTCCTTCA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link