Q90VY7_DANRE

Ensembl ID:
ENSDARG00000018765
Description:
Homeodomain transcription factor Prep1Pbx/knotted 1 homeobox 1.1Pbx/knotted-1 homeobox Prep1.1 [Sour
Human Orthologue:
PKNOX1
Human Description:
PBX/knotted 1 homeobox 1 [Source:HGNC Symbol;Acc:9022]
Mouse Orthologue:
Pknox1
Mouse Description:
Pbx/knotted 1 homeobox Gene [Source:MGI Symbol;Acc:MGI:1201409]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa34607 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa34607
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000125416 Nonsense 209 433 6 11
ENSDART00000129934 Nonsense 209 376 6 12
Genomic Location (Zv9):
Chromosome 9 (position 20348024)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 19728972
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACCTTCGTCTGGTCTTCAACAAGGCAGTGTTACAGTGACCACAGTCAATT[C/A]ATCACAAGTGGCCACAGGTAACACGTTCATCTGTTTTTGAGTCTTCAGTC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link