NPR1 (2 of 2)

Ensembl ID:
ENSDARG00000018750
Description:
natriuretic peptide receptor A/guanylate cyclase A (atrionatriuretic peptide receptor A) [Source:HGN
Human Orthologue:
NPR1
Human Description:
natriuretic peptide receptor A/guanylate cyclase A (atrionatriuretic peptide receptor A) [Source:HGN
Mouse Orthologue:
Npr1
Mouse Description:
natriuretic peptide receptor 1 Gene [Source:MGI Symbol;Acc:MGI:97371]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa36166 Nonsense Mutation detected in F1 DNA During 2017
sa12864 Nonsense Available for shipment Available now
sa16937 Nonsense Available for shipment Available now
sa42742 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa36166
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000018213 Nonsense 383 1070 4 21
Genomic Location (Zv9):
Chromosome 16 (position 31171408)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 29008597
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGATGCTGTACTGCCATGCTTTAAATGAGAGCCTTTCAGACAGCCATGAA[C/T]GACCTTCAGGAGAGTCTGTCAGCAAACGAATGTGGAACCGGACCTATTAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12864
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000018213 Nonsense 398 1070 4 21
ENSDART00000018213 Nonsense 398 1070 4 21
Genomic Location (Zv9):
Chromosome 16 (position 31171455)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 29008644
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GAACGACCTTCAGGAGAGTCTRTCAGCAAACGAATGTGGAACCGGACCTA[T/G]TATGGTGAGTACATGATCCAAATRAAATRGATCATTGTCAAATGTGACWT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16937
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000018213 Nonsense 398 1070 4 21
ENSDART00000018213 Nonsense 398 1070 4 21
Genomic Location (Zv9):
Chromosome 16 (position 31171455)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 29008644
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GAACGACCTTCAGGAGAGTCTRTCAGCAAACGAATGTGGAACCGGACCTA[T/G]TATGGTGAGTACATGATCCAAATRAAATRGATCATTGTCAAATGTGACWT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42742
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000018213 Essential Splice Site 655 1070 12 21
Genomic Location (Zv9):
Chromosome 16 (position 31199143)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 29036332
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTACACTAGATTGGATGTTCAAATACTCATTAATCAGCGACATAGTAAAG[G/A]TAGAAACCCCTTTCTGTATTTTGTTAATGATGAAATTCACGTTAAAGGCA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link