psip1

Ensembl ID:
ENSDARG00000018745
ZFIN ID:
ZDB-GENE-050522-104
Description:
PC4 and SFRS1 interacting protein 1 [Source:RefSeq peptide;Acc:NP_001018562]
Human Orthologue:
PSIP1
Human Description:
PC4 and SFRS1 interacting protein 1 [Source:HGNC Symbol;Acc:9527]
Mouse Orthologue:
Psip1
Mouse Description:
PC4 and SFRS1 interacting protein 1 Gene [Source:MGI Symbol;Acc:MGI:2142116]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa32689 Essential Splice Site Mutation detected in F1 DNA During 2017
sa16450 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa32689
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000123655 Essential Splice Site 162 412 6 15
Genomic Location (Zv9):
Chromosome 1 (position 27223827)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 27469914
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGATGGTGGTGACATGGACGTTTCTGATCAGAGACTTGTTAAAGATGAAG[T/A]AAGTACTTTTATGGTGTGGTGTGGTGTGGTGCAGATGTTTGGTGGATTGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16450
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000123655 Nonsense 408 412 14 15
Genomic Location (Zv9):
Chromosome 1 (position 27255076)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 27501163
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTCCGAAGAGGAYGCTGAGACAGAGAAGGACAAATTAGGAGGAAACATCT[T/G]ATCTATGGTGAAAAAYAAGTAATCAGAAATTCATAATAATAAGCTTAAAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link