psme4b

Ensembl ID:
ENSDARG00000018742
ZFIN IDs:
ZDB-GENE-100316-4, ZDB-GENE-100316-4
Description:
proteasome (prosome, macropain) activator subunit 4b [Source:RefSeq peptide;Acc:NP_001177949]
Human Orthologue:
PSME4
Human Description:
proteasome (prosome, macropain) activator subunit 4 [Source:HGNC Symbol;Acc:20635]
Mouse Orthologue:
Psme4
Mouse Description:
proteasome (prosome, macropain) activator subunit 4 Gene [Source:MGI Symbol;Acc:MGI:2143994]

Alleles

There are 8 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa18110 Essential Splice Site Available for shipment Available now
sa42034 Nonsense Mutation detected in F1 DNA During 2017
sa38893 Nonsense Mutation detected in F1 DNA During 2017
sa35298 Essential Splice Site Mutation detected in F1 DNA During 2017
sa38894 Essential Splice Site Mutation detected in F1 DNA During 2017
sa22097 Nonsense Available for shipment Available now
sa9120 Nonsense Mutation detected in F1 DNA During 2017
sa13795 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa18110
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000003143   None 285 None 7
ENSDART00000128865 Essential Splice Site 115 1827 2 45
Genomic Location (Zv9):
Chromosome 12 (position 25505941)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 23874617
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGATCAGCATGATGCAGAGCTTTGCACGACTCCTCGTCAACTTGCTGAAG[T/G]AMGCAAAAGTCTGACATCAACAATCACCAGACCACTGYCAAATATTTGAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42034
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000003143   None 285 None 7
ENSDART00000128865 Nonsense 291 1827 8 45
Genomic Location (Zv9):
Chromosome 12 (position 25517676)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 23886352
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCAGTTGGCACCAGCCAGATGGTAGTTCCTAGATACTTGACTAACTCCTA[C/A]GACATTGGTCATGTGGTACTTTGGATTTCCTCCATGCTGGTAAGTTTCAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38893
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000003143   None 285 None 7
ENSDART00000128865 Nonsense 636 1827 16 45
Genomic Location (Zv9):
Chromosome 12 (position 25530885)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 23899561
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTTCAGTGTCACCCTGCTGAGTCTCTCAGGCTGTTTGTACCGCACTGCTG[T/A]AACGCCATTACTCATCTAACTGCCAGTGCGTACAAGAAAATAAAACCACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35298
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000003143   None 285 None 7
ENSDART00000128865 Essential Splice Site 861 1827 22 45
Genomic Location (Zv9):
Chromosome 12 (position 25534965)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 23903641
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAGAGAAAACTACCGTGAGGCTGTCTGCAAAGTGATGAGACAGTTGCTTC[G/A]TAAGTGCTCCTCATTTATTGCATCTAACTTCACACACTTTCATTCTTTAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38894
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000003143   None 285 None 7
ENSDART00000128865 Essential Splice Site 1187 1827 31 45
Genomic Location (Zv9):
Chromosome 12 (position 25540985)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 23909661
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TATTCTTCTTTGTACAAAGCCTAAACCACGATGCACTTGTTGTTCGCAAG[G/A]TTGGTGGAATGCTAATGTTTTGGAAGTTTTATAGGGCGCACAGTGATGTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22097
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000003143   None 285 None 7
ENSDART00000128865 Nonsense 1505 1827 40 45
Genomic Location (Zv9):
Chromosome 12 (position 25551307)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 23919983
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCTTTCAGCGTATTGACATACATCTTCATGATTGATGTGGCTCTGCCCTA[C/A]ACTCTGCCCACTAAATCCCCACACATCGCCGAGTTCACCGAGCGGATCCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9120
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000003143 Nonsense 11 285 1 7
ENSDART00000128865 Nonsense 1553 1827 40 45
Genomic Location (Zv9):
Chromosome 12 (position 25551449)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 23920125
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAAACCACGTGGTGGAGGAGAATGGAGTWGGTGAGCAGGACGAAAGGACC[C/T]AGGCCATCAAACTGCTGAAAACAGTGTTGAAGTGGCTGATGGCCAGTGCG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13795
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000003143 Nonsense 140 285 3 7
ENSDART00000128865 Nonsense 1682 1827 42 45
Genomic Location (Zv9):
Chromosome 12 (position 25553875)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 23922551
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGTGTGTTCARGGCGTCAGAGCTCTGGTCATCAGGCTCCTGGAGGACGAG[C/T]AGCTGGAGGTACATCTGGGCCACAATCATTTATTTATTCGCTTTCATGCA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link