MCOLN2

Ensembl ID:
ENSDARG00000018722
Description:
mucolipin 2 [Source:HGNC Symbol;Acc:13357]
Human Orthologue:
MCOLN2
Human Description:
mucolipin 2 [Source:HGNC Symbol;Acc:13357]
Mouse Orthologue:
Mcoln2
Mouse Description:
mucolipin 2 Gene [Source:MGI Symbol;Acc:MGI:1915529]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa44387 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa44387
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000023960 Nonsense 178 561 4 18
Genomic Location (Zv9):
Chromosome Zv9_scaffold3544 (position 17503)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 24601426
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAGGCGATGTCCAACCATCTGAGGATGTCTATGACATTGAGGCCCAGCTT[G/T]AAATAGGTTACACTTTTTTTGTAAATACTGGAATCTGGTAGGAATCGTAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link