npnt

Ensembl ID:
ENSDARG00000018721
ZFIN ID:
ZDB-GENE-090312-201
Description:
nephronectin [Source:RefSeq peptide;Acc:NP_001139052]
Human Orthologue:
NPNT
Human Description:
nephronectin [Source:HGNC Symbol;Acc:27405]
Mouse Orthologue:
Npnt
Mouse Description:
nephronectin Gene [Source:MGI Symbol;Acc:MGI:2148811]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa15583 Essential Splice Site Available for shipment Available now
sa19582 Nonsense Available for shipment Available now
sa19583 Nonsense Available for shipment Available now
sa19584 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa15583
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000018469 Essential Splice Site 57 605 3 13
ENSDART00000134988   None 87 None 3

The following transcripts of ENSDARG00000018721 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 1 (position 50633239)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 49482330
KASP Assay ID:
2259-1087.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CACATTTAGACGKAGCTTCCTTCTTTTTTTGTCTGGCYGTTTGTTTTGCA[G/A]CCCTCTACGTCTTAACCCGCAGAGTAATCGGGATAAGGTGTCARCCCCAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19582
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000018469 Nonsense 83 605 4 13
ENSDART00000134988 Nonsense 66 87 3 3

The following transcripts of ENSDARG00000018721 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 1 (position 50639028)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 49488119
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TACTGATGATCTTTTTGCCTACAGCGCTATGTCAGCACGGATGCAAGCAC[G/T]GAGAATGCGTGGGACCCAACAAATGCAAGTGCCATCCAGGTTATACAGGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19583
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000018469 Nonsense 226 605 7 13
ENSDART00000134988   None 87 None 3

The following transcripts of ENSDARG00000018721 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 1 (position 50678302)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 49527393
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATCTGCAAGTGCCATGACGGCTTTGACCTTCAGTACGTCAATGGGAAATA[T/A]CAGTGTACAGGTAAACATAGTGCACATTCATGGGATAGCAAGCTTTGATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19584
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000018469 Nonsense 281 605 9 13
ENSDART00000134988   None 87 None 3

The following transcripts of ENSDARG00000018721 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 1 (position 50685709)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 49534800
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATCCTCTTTGTTCTCTTTTAGCCATCCCAAAGGTGGTAATTGACCCTCCA[C/T]GACCTGGAAAGACCACACCGAGCAGCAATAACAACAAAGGCGGCAACAAA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link