si:ch211-93a19.1

Ensembl ID:
ENSDARG00000018716
ZFIN ID:
ZDB-GENE-070912-328
Description:
hypothetical protein LOC100137124 [Source:RefSeq peptide;Acc:NP_001108193]
Human Orthologue:
DGKH
Human Description:
diacylglycerol kinase, eta [Source:HGNC Symbol;Acc:2854]
Mouse Orthologue:
Dgkh
Mouse Description:
diacylglycerol kinase, eta Gene [Source:MGI Symbol;Acc:MGI:2444188]

Alleles

There are 7 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa11568 Essential Splice Site Available for shipment Available now
sa8698 Nonsense Mutation detected in F1 DNA During 2017
sa34602 Nonsense Mutation detected in F1 DNA During 2017
sa41389 Nonsense Mutation detected in F1 DNA During 2017
sa34603 Splice Site, Nonsense Mutation detected in F1 DNA During 2017
sa34604 Essential Splice Site Mutation detected in F1 DNA During 2017
sa10472 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa11568
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000013111   None 1194 None 28
ENSDART00000026174 Essential Splice Site 16 1235 1 30
ENSDART00000060356   None 588 None 16
Genomic Location (Zv9):
Chromosome 9 (position 18302332)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 17778402
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TATGGAAGATGACTGCCAATATACTCGCAGCCCTGCCTGGGAAGAACTGG[T/G]CAGTACTGCTGAACATTTTCTAWTCKGACAGACGTCAAAGAGATCCTGTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8698
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000013111 Nonsense 90 1194 2 28
ENSDART00000026174 Nonsense 102 1235 3 30
ENSDART00000060356   None 588 None 16
Genomic Location (Zv9):
Chromosome 9 (position 18346563)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 17822633
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAGCGTTGGAAAAAACGTTATTTCAAGCTACGAGGACGGACRCTCTACTA[T/A]GCTAAGGATGYCAAGGTGMCTTTTCCACCACACAGGCCTGCTGTAGTTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34602
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000013111 Nonsense 367 1194 9 28
ENSDART00000026174 Nonsense 379 1235 10 30
ENSDART00000060356 Nonsense 228 588 6 16
Genomic Location (Zv9):
Chromosome 9 (position 18415516)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 17891586
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCTGCTCAATCCTGCTCAGGTCTTTGACCTGGTCAACGGTGGACCTCATT[T/A]AGGGTAAGACCAGGATGTCAGAGGTCATGGAGTATGAACTAAATCAAATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41389
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000013111 Nonsense 460 1194 12 28
ENSDART00000026174 Nonsense 472 1235 13 30
ENSDART00000060356 Nonsense 321 588 9 16
Genomic Location (Zv9):
Chromosome 9 (position 18419394)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 17895464
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTACATCTGCAGCTGCTGTTTACAGGTGGAGTATAATGACGTATGAGATT[A/T]AAATACCTCCCAAACACAGCTGTCCTGCTACGCCTGAGGAGGCAGAGGAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34603
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Splice Site, Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000013111 Splice Site, Nonsense 479 1194 13 28
ENSDART00000026174 Splice Site, Nonsense 491 1235 14 30
ENSDART00000060356 Splice Site, Nonsense 340 588 10 16
Genomic Location (Zv9):
Chromosome 9 (position 18423798)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 17899868
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCTTCAAGATGCAAGCATGGCATGATGTGATCCGTTTTTCTGGTTTTAGT[T/A]ACAGATATCAGCTTATGAGGATTCAGTGGCTGCTCATCTCACAAAGATTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34604
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000013111   1194 1194 28 28
ENSDART00000026174 Essential Splice Site 1207 1235 29 30
ENSDART00000060356   None 588 None 16
Genomic Location (Zv9):
Chromosome 9 (position 18456428)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 17932498
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACGACATCCGCGGCTCCGAGCTCCTGCACCTGGAGAGGAGAGACCTTAAG[G/A]TATACACACAACCCCTTTTCTGTGCCTCACGATGTCCCTCAGATCAACCG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10472
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000013111   None 1194 None 28
ENSDART00000026174   None 1235 None 30
ENSDART00000060356 Nonsense 548 588 16 16
Genomic Location (Zv9):
Chromosome 9 (position 18476436)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 17952506
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCCATTTAGGAGAAGTGCGACGCGAGTTTCATTTGTTTACATTGTGTTTA[C/A]GATTGGCACAGTTTCATTTTTAAGACTACATGTATAGCTATATTTACAAA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Bipolar disorder: A genome-wide association study implicates diacylglycerol kinase eta (DGKH) and several other genes in the etiology of bipolar disorder. (View Study)
  • Height: A genome-wide association study in 19 633 Japanese subjects identified LHX3-QSOX2 and IGF1 as adult height loci. (View Study)
  • Nephrolithiasis: A genome-wide association study of nephrolithiasis in the Japanese population identifies novel susceptible Loci at 5q35.3, 7p14.3, and 13q14.1. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link