carm1

Ensembl ID:
ENSDARG00000018698
ZFIN ID:
ZDB-GENE-040724-77
Description:
Histone-arginine methyltransferase CARM1 [Source:UniProtKB/Swiss-Prot;Acc:Q6DC04]
Human Orthologue:
CARM1
Human Description:
coactivator-associated arginine methyltransferase 1 [Source:HGNC Symbol;Acc:23393]
Mouse Orthologue:
Carm1
Mouse Description:
coactivator-associated arginine methyltransferase 1 Gene [Source:MGI Symbol;Acc:MGI:1913208]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa20063 Nonsense Available for shipment Available now
sa6903 Nonsense Mutation detected in F1 DNA During 2014
sa16930 Essential Splice Site Available for shipment Available now
sa10441 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa20063
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000006091 Nonsense 123 588 3 16
Genomic Location:
Chromosome 3 (position 34238836)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GACCGTTCAGTCTTTAGTGACAGGACAGAGGAGTCTTCAGCTGTACAGTA[T/A]TTTCAGGTGTGTCTGGCTTCTTATTGCCCTGCACGTGCAGATATTCATTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6903
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000006091 Nonsense 127 588 4 16
Genomic Location:
Chromosome 3 (position 34239004)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGGCATGTTGTGAACATCTTTTTCCCTCCATTTTCTTTCTCTCAGTTTTA[T/A]GGGTATCTCTCTCAGCAACAAAACATGATGCAGGATTATGTACGAACTGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16930
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000006091 Essential Splice Site 287 588 7 16
Genomic Location:
Chromosome 3 (position 34242638)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCACAGAYGAGCAGCTTTACAWGGAGCAGTTTACAAAGGCCAATTTTTGG[T/G]GAGCTTTCTTAAAGAGGACATGGACACTGGGTGGGGAGAGAGAGAGGGAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10441
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000006091 Essential Splice Site 449 588 12 16
Genomic Location:
Chromosome 3 (position 34247332)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAGGCTCCAAATCCAGTAATCTACTTGATCKCAAGAACCCTTTCTTCCGG[T/G]GAGTGAATGCATTTCTTTGGAAACCAACTAAACAATGCAGAAYACATGCT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/tpwzdryp