cdh2

Ensembl ID:
ENSDARG00000018693
ZFIN ID:
ZDB-GENE-990415-171
Description:
Cadherin-2 [Source:UniProtKB/Swiss-Prot;Acc:Q90275]
Human Orthologue:
CDH2
Human Description:
cadherin 2, type 1, N-cadherin (neuronal) [Source:HGNC Symbol;Acc:1759]
Mouse Orthologue:
Cdh2
Mouse Description:
cadherin 2 Gene [Source:MGI Symbol;Acc:MGI:88355]

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa206 Nonsense F2 line generated During 2016
sa16882 Essential Splice Site Available for shipment Available now
sa15918 Nonsense Available for shipment Available now
sa32283 Nonsense Available for shipment Available now
sa11989 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa206
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000024627 Nonsense 28 893 2 16

The following transcripts of ENSDARG00000018693 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 20 (position 17789419)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 17843919
KASP Assay ID:
554-0152.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTTTGTGTTTTTGGCAGGTGGCGGTCCAGGGCACAGGGGCGATGCCATGT[C/T]AGCCTGGTTTCACCGAGAACGAGTACAACGTCATGACAGCCGACGTCATC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16882
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000024627 Essential Splice Site 52 893 2 16

The following transcripts of ENSDARG00000018693 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 20 (position 17789495)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 17843995
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAACGTCATGACAGCCGAMGTCATCACCGAGGGACAAGTTCTGCTCAAAG[G/A]TAAACAAAGACGTTTTCTTTACATGCATACTTAGAATAAACGGACCAATC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15918
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000024627 Nonsense 517 893 10 16

The following transcripts of ENSDARG00000018693 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 20 (position 17848927)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 17903427
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGTCRATGCTAACGACTTTYACAGCTCATGATCCAGACAGATATATGCAG[C/T]AGACTATTAGGTATTAAAGMAMACACATCTRCATATATACAYATGGTTTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32283
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000024627 Nonsense 558 893 11 16

The following transcripts of ENSDARG00000018693 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 20 (position 17849522)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 17904022
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACCATTGCTGTTTTGGATCGAGAATCTCCTTACGTGAAAAATAACCTTTA[C/A]AACGCCACATTCATGGCTTCAGACAATGGTAAGAGCAATGTTGTGTGTGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11989
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000024627 Essential Splice Site 568 893 11 16

The following transcripts of ENSDARG00000018693 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 20 (position 17849552)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 17904052
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TACGTGAAAAATAACCTTTACAACGCCAYATTCATGGCTTCAGACAATGG[T/A]AAGAGCAATGTTGTGTGTGTCNNNNTGTGTGTGTGTGTGTATGCATAAGC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link