cdh2

Ensembl ID:
ENSDARG00000018693
ZFIN ID:
ZDB-GENE-990415-171
Description:
Cadherin-2 [Source:UniProtKB/Swiss-Prot;Acc:Q90275]
Human Orthologue:
CDH2
Human Description:
cadherin 2, type 1, N-cadherin (neuronal) [Source:HGNC Symbol;Acc:1759]
Mouse Orthologue:
Cdh2
Mouse Description:
cadherin 2 Gene [Source:MGI Symbol;Acc:MGI:88355]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa206 Nonsense F2 line generated During 2014
sa16882 Essential Splice Site Available for shipment Available now
sa15918 Nonsense Available for shipment Available now
sa11989 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa206
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000024627 Nonsense 28 893 2 16

The following transcripts of ENSDARG00000018693 do not overlap with this mutation:

Genomic Location:
Chromosome 20 (position 17789419)
KASP Assay ID:
554-0152.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTTTGTGTTTTTGGCAGGTGGCGGTCCAGGGCACAGGGGCGATGCCATGT[C/T]AGCCTGGTTTCACCGAGAACGAGTACAACGTCATGACAGCCGACGTCATC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16882
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000024627 Essential Splice Site 52 893 2 16

The following transcripts of ENSDARG00000018693 do not overlap with this mutation:

Genomic Location:
Chromosome 20 (position 17789495)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAACGTCATGACAGCCGAMGTCATCACCGAGGGACAAGTTCTGCTCAAAG[G/A]TAAACAAAGACGTTTTCTTTACATGCATACTTAGAATAAACGGACCAATC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15918
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000024627 Nonsense 517 893 10 16

The following transcripts of ENSDARG00000018693 do not overlap with this mutation:

Genomic Location:
Chromosome 20 (position 17848927)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGTCRATGCTAACGACTTTYACAGCTCATGATCCAGACAGATATATGCAG[C/T]AGACTATTAGGTATTAAAGMAMACACATCTRCATATATACAYATGGTTTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11989
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000024627 Essential Splice Site 568 893 11 16

The following transcripts of ENSDARG00000018693 do not overlap with this mutation:

Genomic Location:
Chromosome 20 (position 17849552)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TACGTGAAAAATAACCTTTACAACGCCAYATTCATGGCTTCAGACAATGG[T/A]AAGAGCAATGTTGTGTGTGTCNNNNTGTGTGTGTGTGTGTATGCATAAGC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/50bspg0j