phf2

Ensembl ID:
ENSDARG00000018691
ZFIN ID:
ZDB-GENE-050302-10
Description:
PHD finger protein 2 [Source:UniProtKB/Swiss-Prot;Acc:Q6P949]
Human Orthologue:
PHF2
Human Description:
PHD finger protein 2 [Source:HGNC Symbol;Acc:8920]
Mouse Orthologue:
Phf2
Mouse Description:
PHD finger protein 2 Gene [Source:MGI Symbol;Acc:MGI:1338034]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa9456 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa9456
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000045942 Nonsense 842 1075 18 22
ENSDART00000125352 Nonsense 838 1093 18 24
Genomic Location (Zv9):
Chromosome 11 (position 28532580)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 27408566
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAGCCAGCAAGAAGCCRAGCSGTGCGGCCGGAGCAGGAGGGAACAGCAAA[C/T]GACCTGCYAAACGCTTGCCCAAAAAGACCCAAAAGAGCAGCAGCGTGGAC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link