itga2b

Ensembl ID:
ENSDARG00000018687
ZFIN ID:
ZDB-GENE-051031-1
Description:
integrin alpha-IIb [Source:RefSeq peptide;Acc:NP_001003857]
Human Orthologue:
ITGA2B
Human Description:
integrin, alpha 2b (platelet glycoprotein IIb of IIb/IIIa complex, antigen CD41) [Source:HGNC Symbol
Mouse Orthologue:
Itga2b
Mouse Description:
integrin alpha 2b Gene [Source:MGI Symbol;Acc:MGI:96601]

Alleles

There are 8 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa83 Essential Splice Site Confirmed mutation in F2 line During 2016
sa40053 Essential Splice Site Mutation detected in F1 DNA During 2016
sa19 Nonsense Confirmed mutation in F2 line During 2016
sa40052 Nonsense Mutation detected in F1 DNA During 2016
sa30831 Nonsense Mutation detected in F1 DNA During 2016
sa10134 Nonsense Available for shipment Available now
sa40051 Essential Splice Site Mutation detected in F1 DNA During 2016
sa26046 Essential Splice Site Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa83
Current Status:
Confirmed mutation in F2 line
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000016562 Essential Splice Site 131 1037 3 30
Genomic Location (Zv9):
Chromosome 3 (position 21592561)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 21248952
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAACCAGTGGTTGGGTGCTTCAGTTCGAACCTACAACAACTACATCTTGG[T/A]GAGTTACTGTGAGTTCCTTAACCACACTATTCTTCCTGTCAAAGCTGTAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40053
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000016562 Essential Splice Site 287 1037 9 30
Genomic Location (Zv9):
Chromosome 3 (position 21589832)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 21246223
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTGCAGATTATGTTGTTGGCGTCCCAAATGATCTGCACACTGCAGGCTCT[G/T]TAAGTGTTCTTGTTACTTGGATAATAATGCACTTCAATTATGGTCTTGCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19
Current Status:
Confirmed mutation in F2 line
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000016562 Nonsense 355 1037 12 30
Genomic Location (Zv9):
Chromosome 3 (position 21588634)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 21245025
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAGCAGCTGTCCACGCAGAAATTTCGAGAAGTGGGACAGGTGTATGTTTA[C/A]CTGCAAAGAAATGACTTCTCCTTCGCCTCCAGACCCAACCAGATCCTGGC
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Mutation Details

Allele Name:
sa40052
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000016562 Nonsense 405 1037 13 30
ENSDART00000016562 Nonsense 405 1037 13 30
Genomic Location (Zv9):
Chromosome 3 (position 21584159)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 21240550
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TAGCACGTGTATTCATTTCTCCTCAGATGTGGCAGTGGGAGCGCCTGGTT[C/A]AGTTGATGGGGGTAAAGTGTTTATTTACCTGGGTAAGAGTGGTGGTTTGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa30831
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000016562 Nonsense 405 1037 13 30
ENSDART00000016562 Nonsense 405 1037 13 30
Genomic Location (Zv9):
Chromosome 3 (position 21584159)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 21240550
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TAGCACGTGTATTCATTTCTCCTCAGATGTGGCAGTGGGAGCGCCTGGTT[C/A]AGTTGATGGGGGTAAAGTGTTTATTTACCTGGGTAAGAGTGGTGGTTTGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10134
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000016562 Nonsense 616 1037 19 30
Genomic Location (Zv9):
Chromosome 3 (position 21574371)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 21230762
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTACTATTAATTCCCCTAACCTGCTGAAAACTGTTTCTTCTGTTTAGACA[C/T]GAATAATACTAAACTGTGGTCCTGATAATGTCTGTAWTCCAGACCTGCAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40051
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000016562 Essential Splice Site 718 1037 22 30
Genomic Location (Zv9):
Chromosome 3 (position 21573424)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 21229815
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATTTTCAGCCCACTGTGGAACATCCCGCTCTCTGTTGTTTTTCTCATTCA[G/A]CTGAAAGCAGGTCTTTACTTCAGCATGGGTGATCTGGAACAGGTGGAGAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa26046
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000016562 Essential Splice Site 1009 1037 29 30
Genomic Location (Zv9):
Chromosome 3 (position 21564562)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 21220953
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCGTCGCTGGACTGCTTCTATTGGCTGCGCTGAGCACCATCTTCTGGAAG[G/A]TACTTCTATGGGTTTAACAGCAGAGGGAGCTATAATTGTCCCTTAAAGAT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link