itga2b

Ensembl ID:
ENSDARG00000018687
ZFIN ID:
ZDB-GENE-051031-1
Description:
integrin alpha-IIb [Source:RefSeq peptide;Acc:NP_001003857]
Human Orthologue:
ITGA2B
Human Description:
integrin, alpha 2b (platelet glycoprotein IIb of IIb/IIIa complex, antigen CD41) [Source:HGNC Symbol
Mouse Orthologue:
Itga2b
Mouse Description:
integrin alpha 2b Gene [Source:MGI Symbol;Acc:MGI:96601]

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa3468 Essential Splice Site Mutation detected in F1 DNA During 2014
sa18752 Essential Splice Site Mutation detected in F1 DNA During 2014
sa83 Essential Splice Site Confirmed mutation in F2 line During 2014
sa19 Nonsense Confirmed mutation in F2 line During 2014
sa10134 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa3468
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000016562 Essential Splice Site 98 1037 2 30
ENSDART00000016562 Essential Splice Site 98 1037 2 30
Genomic Location:
Chromosome 3 (position 21593666)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTGGRCAACAAGAGGACAATCATGTCAGACCTTAAACTTTGACCAAAAAG[G/A]TGAGTAAACTCCTCCAGTATGTACTGTATATGGAATACATACCAAAATAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18752
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000016562 Essential Splice Site 98 1037 2 30
ENSDART00000016562 Essential Splice Site 98 1037 2 30
Genomic Location:
Chromosome 3 (position 21593666)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTGGGCAACAAGAGGACAATCATGTCAGACCTTAAACTTTGACCAAAAAG[G/A]TGAGTAAACTCCTCCAGTATGTACTGTATATGGAATACATACCAAAATAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa83
Current Status:
Confirmed mutation in F2 line
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000016562 Essential Splice Site 131 1037 3 30
Genomic Location:
Chromosome 3 (position 21592561)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAACCAGTGGTTGGGTGCTTCAGTTCGAACCTACAACAACTACATCTTGG[T/A]GAGTTACTGTGAGTTCCTTAACCACACTATTCTTCCTGTCAAAGCTGTAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19
Current Status:
Confirmed mutation in F2 line
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000016562 Nonsense 355 1037 12 30
Genomic Location:
Chromosome 3 (position 21588634)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAGCAGCTGTCCACGCAGAAATTTCGAGAAGTGGGACAGGTGTATGTTTA[C/A]CTGCAAAGAAATGACTTCTCCTTCGCCTCCAGACCCAACCAGATCCTGGC
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Mutation Details

Allele Name:
sa10134
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000016562 Nonsense 616 1037 19 30
Genomic Location:
Chromosome 3 (position 21574371)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTACTATTAATTCCCCTAACCTGCTGAAAACTGTTTCTTCTGTTTAGACA[C/T]GAATAATACTAAACTGTGGTCCTGATAATGTCTGTAWTCCAGACCTGCAG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/01sudkln