saal1

Ensembl ID:
ENSDARG00000018681
ZFIN ID:
ZDB-GENE-040426-725
Description:
Protein saal1 [Source:UniProtKB/Swiss-Prot;Acc:Q803M5]
Human Orthologue:
SAAL1
Human Description:
serum amyloid A-like 1 [Source:HGNC Symbol;Acc:25158]
Mouse Orthologue:
Saal1
Mouse Description:
serum amyloid A-like 1 Gene [Source:MGI Symbol;Acc:MGI:1926185]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa7536 Missense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa7536
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Missense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000006579 Missense 260 469 8 13
Genomic Location (Zv9):
Chromosome 25 (position 8452141)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 8064578
KASP Assay ID:
554-4049.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTGACCTGCAGACAGACAACCAGCCGGACATCCTGTCCTCTCTGCTGGAG[G/A]CCGCCAAGCAGCTCAGGTAAGACGCACAGTACAGGAARACCTGCCGAGGG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link