LOC100330155

Ensembl ID:
ENSDARG00000018619
Human Orthologue:
LASS4
Human Description:
LAG1 homolog, ceramide synthase 4 [Source:HGNC Symbol;Acc:23747]
Mouse Orthologue:
Lass4
Mouse Description:
LAG1 homolog, ceramide synthase 4 Gene [Source:MGI Symbol;Acc:MGI:1914510]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa1656 Essential Splice Site Available for shipment Available now
sa9557 Nonsense Available for shipment Available now
sa25943 Essential Splice Site Mutation detected in F1 DNA During 2015

Mutation Details

Allele Name:
sa1656
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000036240 Essential Splice Site 155 402 4 10
Genomic Location:
Chromosome 2 (position 56582878)
KASP Assay ID:
554-1603.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTGCCTTCTACCTGGTGGCCTTCACCGCGGGACTGCTGTCTTTAATTAAC[G/A]TRAGTGTCGTTTCAAGCTTTATTCCTCAKGAGTCTTCATCTAATTACTGT
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Mutation Details

Allele Name:
sa9557
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000036240 Nonsense 172 402 5 10
Genomic Location:
Chromosome 2 (position 56580089)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGACGGCCTGGTTCWGGGAWCAGARAGAGTGCTGGAGAGGGTTTCCTCGA[C/T]AGGTCAGATTAATGCACACAAACACATTCATTCATAAGAAACATACTAGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa25943
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2015.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000036240 Essential Splice Site 282 402 8 10
Genomic Location:
Chromosome 2 (position 56572680)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATCTTCGCTGCTGTTTTCCTGGTGACTCGACTGCTGGTGTTTCCTAGCAA[G/A]TGAGAGTTTGAAGTATTGATTTTCCATCTAAAACTATGAGAGTGTGTGTT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/avwxh1z0