LOC100330155

Ensembl ID:
ENSDARG00000018619
Human Orthologue:
LASS4
Human Description:
LAG1 homolog, ceramide synthase 4 [Source:HGNC Symbol;Acc:23747]
Mouse Orthologue:
Lass4
Mouse Description:
LAG1 homolog, ceramide synthase 4 Gene [Source:MGI Symbol;Acc:MGI:1914510]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa1656 Essential Splice Site Available for shipment Available now
sa9557 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa1656
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000036240 Essential Splice Site 155 402 4 10
Genomic Location:
Chromosome 2 (position 56582878)
KASP Assay ID:
554-1603.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTGCCTTCTACCTGGTGGCCTTCACCGCGGGACTGCTGTCTTTAATTAAC[G/A]TRAGTGTCGTTTCAAGCTTTATTCCTCAKGAGTCTTCATCTAATTACTGT
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Mutation Details

Allele Name:
sa9557
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000036240 Nonsense 172 402 5 10
Genomic Location:
Chromosome 2 (position 56580089)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGACGGCCTGGTTCWGGGAWCAGARAGAGTGCTGGAGAGGGTTTCCTCGA[C/T]AGGTCAGATTAATGCACACAAACACATTCATTCATAAGAAACATACTAGC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/avwxh1z0