cpsf6

Ensembl ID:
ENSDARG00000018618
ZFIN ID:
ZDB-GENE-030131-5277
Description:
Cleavage and polyadenylation specificity factor subunit 6 [Source:UniProtKB/Swiss-Prot;Acc:Q6NWC6]
Human Orthologue:
CPSF6
Human Description:
cleavage and polyadenylation specific factor 6, 68kDa [Source:HGNC Symbol;Acc:13871]
Mouse Orthologue:
Cpsf6
Mouse Description:
cleavage and polyadenylation specific factor 6 Gene [Source:MGI Symbol;Acc:MGI:1913948]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa9322 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa9322
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000038346 None None 148 4 11
ENSDART00000082289 Nonsense 172 558 4 10
ENSDART00000129521 Nonsense 172 545 4 10
ENSDART00000138291 None None 117 None 4
Genomic Location:
Chromosome 4 (position 1917544)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCGTCACYCCTTGCAAYAAACAGTCTCTCAGYCAGTTCGAGATGCAGTCA[C/T]GAAAAAGTGAGCGCAGAGGATTCGACAATTCACATTATCATAAAGGTCCC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Height: Many sequence variants affecting diversity of adult human height. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/xp2di97u