lbx1b

Ensembl ID:
ENSDARG00000018611
ZFIN ID:
ZDB-GENE-050309-27
Description:
ladybird homeobox 1a [Source:RefSeq peptide;Acc:NP_001156784]
Human Orthologue:
LBX1
Human Description:
ladybird homeobox 1 [Source:HGNC Symbol;Acc:16960]
Mouse Orthologue:
Lbx1
Mouse Description:
ladybird homeobox homolog 1 (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:104867]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
hu3534 Nonsense Confirmed mutation in F2 line Unknown

Mutation Details

Allele Name:
hu3534
Current Status:
Confirmed mutation in F2 line
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Unknown
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000007770 Nonsense 72 189 1 2
ENSDART00000123968 Nonsense 60 126 1 3
ENSDART00000131016 Nonsense 72 265 1 2
Genomic Location:
Chromosome 1 (position 30987597)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACCGACTTCCAGCATCAGACAGAGTCCGACAGAGCATCACCGTTTCCAGG[C/T]AGACTCTCATCACTCAAGCCTCGCCTCTGTGCGCTCTGCAGGAACTGGCG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Scoliosis: A genome-wide association study identifies common variants near LBX1 associated with adolescent idiopathic scoliosis. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/lkdbm425