retsat

Ensembl ID:
ENSDARG00000018600
ZFIN ID:
ZDB-GENE-050320-11
Description:
Putative all-trans-retinol 13,14-reductase [Source:UniProtKB/Swiss-Prot;Acc:Q5BLE8]
Human Orthologue:
RETSAT
Human Description:
retinol saturase (all-trans-retinol 13,14-reductase) [Source:HGNC Symbol;Acc:25991]
Mouse Orthologue:
Retsat
Mouse Description:
retinol saturase (all trans retinol 13,14 reductase) Gene [Source:MGI Symbol;Acc:MGI:1914692]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa33257 Nonsense Mutation detected in F1 DNA During 2017
sa44567 Nonsense Mutation detected in F1 DNA During 2017
sa1025 Nonsense F2 line generated During 2017

Mutation Details

Allele Name:
sa33257
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000013167 Nonsense 127 607 3 11
Genomic Location (Zv9):
Chromosome 3 (position 39184112)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 39047472
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCTTTTTTCAGGCATCCACTATATTGGGGAACTGTCGAATCACAAGCCGT[T/G]ACGCTGTATTATTGACCAAATGACCAATGGGCAGCTGCAGTGGGATCCGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa44567
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000013167 Nonsense 373 607 7 11
Genomic Location (Zv9):
Chromosome 3 (position 39179786)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTTTTGGGTGTTGTTTTTATTCTCATCCTCTACAGCAATTCAGAAACAGT[T/A]GAGTATGCTGCAGCATGGAGACAGTGGTCTCAGCATTTTCATTGGCCTGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1025
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000013167 Nonsense 530 607 10 11
Genomic Location (Zv9):
Chromosome 3 (position 39178950)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 39042310
KASP Assay ID:
554-0929.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACCCCAATCACTAATCAGCATTACATTGCCGCACCTAGGGGAGAGATTTA[T/A]GGCGCTGATCATGGAATTCCTCGCTTCAGTGCTGAACTGAATGCCACCAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link