tnfrsf1a

Ensembl ID:
ENSDARG00000018569
ZFIN ID:
ZDB-GENE-040426-2252
Description:
tumor necrosis factor receptor superfamily member 1A [Source:RefSeq peptide;Acc:NP_998355]
Human Orthologue:
TNFRSF1A
Human Description:
tumor necrosis factor receptor superfamily, member 1A [Source:HGNC Symbol;Acc:11916]
Mouse Orthologue:
Tnfrsf1a
Mouse Description:
tumor necrosis factor receptor superfamily, member 1a Gene [Source:MGI Symbol;Acc:MGI:1314884]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa8496 Essential Splice Site Mutation detected in F1 DNA During 2014
sa15813 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa8496
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000002493 Essential Splice Site 53 389 3 10
Genomic Location:
Chromosome 16 (position 19132987)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AATGAATACTGGAATAAGGAAGGATTCWGCTGTGATAAATGCCATCAAGG[T/G]AAAGAAAATTAATTCAGTCCTTTATGAAACTGAACTTTCAGTTGGCATTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15813
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000002493 Essential Splice Site 201 389 8 10
Genomic Location:
Chromosome 16 (position 19128559)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TAMTGCTGAGGTCTATTTAATGTTGCTTAAACTCTTCRWGTTAAWGTTTC[A/T]GACACGGTACCTAAAATAGTAGTTCCTGTTTGTGCAAGTATCATGGTTCT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/kz05cgmf