ENSDARG00000018566

Ensembl ID:
ENSDARG00000018566
Human Orthologue:
FLNC
Human Description:
filamin C, gamma [Source:HGNC Symbol;Acc:3756]
Mouse Orthologue:
Flnc
Mouse Description:
filamin C, gamma Gene [Source:MGI Symbol;Acc:MGI:95557]

Alleles

There are 9 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa24724 Nonsense Mutation detected in F1 DNA During 2016
sa8067 Nonsense Mutation detected in F1 DNA During 2016
sa38132 Nonsense Mutation detected in F1 DNA During 2016
sa39492 Nonsense Mutation detected in F1 DNA During 2016
sa6812 Nonsense Mutation detected in F1 DNA During 2016
sa18138 Nonsense Available for shipment Available now
sa15040 Essential Splice Site Available for shipment Available now
sa38133 Nonsense Mutation detected in F1 DNA During 2016
sa38134 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa24724
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000046218 Nonsense 53 2719 1 48
Genomic Location:
Chromosome 25 (position 36081461)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAGGACGCGCCGTGGAAGAAGATCCAACAGAACACCTTCACCAGGTGGTG[C/A]AATGAACACCTCAAATGCGTTAATAAGGGCGTCACTGACCTGCAGAAAGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8067
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000046218 Nonsense 58 2719 1 48
Genomic Location:
Chromosome 25 (position 36081474)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGAAGAAGATCCAACAGAACACCTTCACCAGGTGGTGCAATGAACACCTY[A/T]AATGCGTTAATAAGGGCGTCACTGACCTGCAGAAAGACCTGGGCGATGGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38132
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000046218 Nonsense 91 2719 1 48
Genomic Location:
Chromosome 25 (position 36081573)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCCTCAAACTCATCTCGCTTTTGGAAGTCCTCAGTCAGAAGAAAATGTAC[A/T]GAAAACATCACGTCAGGCCAAACTTCAGACAGATGAAGCTGGAGAACGTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39492
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000046218 Nonsense 192 2719 2 48
Genomic Location:
Chromosome 25 (position 36085102)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATTCAGAACAAAGTGCCAGAGCTGCCTATTAACAACTTCAACAAGGACTG[G/A]AGGGATGGCAAGGCTCTTGGCGCCCTAGTGGACAACTGTGCCCCTGGTAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6812
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000046218 Nonsense 216 2719 3 48
Genomic Location:
Chromosome 25 (position 36085855)
KASP Assay ID:
554-4147.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CATATAACTTTAACTCTTTATGTAGGTCTGTGCCCTGACTGGCAAACATG[G/A]GACCCCAACCAGCCWGTGGAAAATGCTCGTGAGGCCATGCAGCAGGCCGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18138
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000046218 Nonsense 898 2719 18 48
Genomic Location:
Chromosome 25 (position 36090761)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CATTCAAAGTCAAGGTGGACCCATCTCATGATGCTGGTAAAGTCAGAGCT[G/T]AAGGTCCTGGAATTWACAAGACAGGTGGGTGTMATCCACAACTTTAAGAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15040
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000046218 Essential Splice Site 906 2719 19 48
Genomic Location:
Chromosome 25 (position 36090859)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GAACGTGAGCCCTGGAGAAATTCCRATCAACWRACACAGCTCTRCTTTAC[A/T]GGCGTTCAGGTGGAAATTCCAACCCATTTCACCATCTTCACCAAAGGAGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38133
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000046218 Nonsense 1346 2719 23 48
Genomic Location:
Chromosome 25 (position 36092704)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATATCACTGATAAGGGTGATGGCACATATAGAGTGGAATATACAGCTTTC[G/T]AGGATGGTATGTAACTAAAACGCTTATATAAGAAACACACACACACACAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38134
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000046218 Nonsense 2670 2719 48 48
Genomic Location:
Chromosome 25 (position 36101222)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTTTCTTTCTTTCAGGTACAAACATGCTCATGGTTGGTGTCCACGGTCCT[A/T]GAACTCCATGTGAAGATGTGACAGTCAAGCATATGGGAAACAAGCTTTAC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link