KDM7B_DANRE

Ensembl ID:
ENSDARG00000018559
Description:
Lysine-specific demethylase 7B [Source:UniProtKB/Swiss-Prot;Acc:P0CF52]
Human Orthologue:
JHDM1D
Human Description:
jumonji C domain containing histone demethylase 1 homolog D (S. cerevisiae) [Source:HGNC Symbol;Acc:
Mouse Orthologue:
Jhdm1d
Mouse Description:
jumonji C domain-containing histone demethylase 1 homolog D (S. cerevisiae) Gene [Source:MGI Symbol;

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa24640 Essential Splice Site Available for shipment Available now
sa12028 Essential Splice Site Available for shipment Available now
sa18167 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa24640
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000050379 Essential Splice Site 62 919 2 20
Genomic Location (Zv9):
Chromosome 25 (position 17627369)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 17174210
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GACGTCTACCACTGTCCCAACTGTGATGTCCACCACGGACCCTCTCTCAG[T/C]AAGTCTCCTCTTTTTAGATTGTTTGATTTCCCCTTGCCACTTTATTTAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12028
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000050379 Essential Splice Site 264 919 6 20
Genomic Location (Zv9):
Chromosome 25 (position 17640354)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 17187195
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTTCCATATTGATTTCGGGGGCACGTCTGTGTGGTACCATGTATTGTGGG[T/A]AAGCTCTGRTCCAGTTTATTAGAGAATCTTGAAAATATGGGTTTCCACAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18167
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000050379 Essential Splice Site 443 919 11 20
Genomic Location (Zv9):
Chromosome 25 (position 17652649)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 17199490
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GACCCAACCATCTCATTAAAWTGCTCACCAAGGAAATCCAGTACCTTGAG[G/A]TAAGACCWGCCTMATGAAACCTGCTTATATTTGGACAGACACATTTGAAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link