ifih1

Ensembl ID:
ENSDARG00000018553
ZFIN ID:
ZDB-GENE-081104-438
Description:
Novel protein similar to vertebrate interferon induced with helicase C domain 1 (IFIH1) [Source:UniP
Human Orthologue:
IFIH1
Human Description:
interferon induced with helicase C domain 1 [Source:HGNC Symbol;Acc:18873]
Mouse Orthologue:
Ifih1
Mouse Description:
interferon induced with helicase C domain 1 Gene [Source:MGI Symbol;Acc:MGI:1918836]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa13902 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa13902
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000003913 Nonsense 968 997 16 16
ENSDART00000138990 Nonsense 675 704 12 12
Genomic Location:
Chromosome 9 (position 52563263)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACTTTGTRGTCACATACGGCTCCAAGAAGAAGACGTTCAGCAAATGGAGA[G/T]AGCTGTCCATAAGCTTCCCTGCATTTGACTACACCCAGCACGCCGATCTC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/n63qisin