si:dkey-19f23.2

Ensembl ID:
ENSDARG00000018542
ZFIN ID:
ZDB-GENE-060503-243
Description:
hyaluronan and proteoglycan link protein 4 [Source:RefSeq peptide;Acc:NP_001038372]
Human Orthologue:
HAPLN4
Human Description:
hyaluronan and proteoglycan link protein 4 [Source:HGNC Symbol;Acc:31357]
Mouse Orthologue:
Hapln4
Mouse Description:
hyaluronan and proteoglycan link protein 4 Gene [Source:MGI Symbol;Acc:MGI:2679531]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa15049 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa15049
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000041351 Nonsense 219 381 4 5
ENSDART00000136016 Nonsense 182 344 3 4
Genomic Location (Zv9):
Chromosome 22 (position 18053290)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 17804225
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTGGCTTGAGGGTTTRGATTGGTGCAATGCTGGCTGGTTAGAGGAYGGCT[C/A]AGTCCAGTATYCCATCTCCCACCCCAGAGACCAGTGTGGCCGCAAAGACA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link