mapkapk2b

Ensembl ID:
ENSDARG00000018530
ZFIN ID:
ZDB-GENE-071018-1
Description:
mitogen-activated protein kinase-activated protein kinase 2b [Source:RefSeq peptide;Acc:NP_00109527
Human Orthologue:
MAPKAPK2
Human Description:
mitogen-activated protein kinase-activated protein kinase 2 [Source:HGNC Symbol;Acc:6887]
Mouse Orthologue:
Mapkapk2
Mouse Description:
MAP kinase-activated protein kinase 2 Gene [Source:MGI Symbol;Acc:MGI:109298]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa1101 Nonsense F2 line generated During 2014
sa9002 Essential Splice Site Mutation detected in F1 DNA During 2014
sa21345 Essential Splice Site Mutation detected in F1 DNA During 2014
sa18024 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa1101
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000003954 Nonsense 56 397 1 10
Genomic Location:
Chromosome 8 (position 38577742)
KASP Assay ID:
554-1003.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCAAAAAGAAAGTAATAACAGAGGAGTATAAGCTTGCAGGACAAGTACTC[G/T]GAATAGGCATTAATGGAAAGGTTWGGGAGATATTCCAGAAGAAAAGTGGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9002
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000003954 Essential Splice Site 173 397 4 10
Genomic Location:
Chromosome 8 (position 38579857)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAGCTGTTGAGTTTCTRCATGGTATCAATATTGCACACAGAGACCTCAAG[G/A]TAAGCAACTCTATAGCCAAAWATCTGAYATTTATTTTAGGGTTATTACAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21345
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000003954 Essential Splice Site 216 397 5 10
Genomic Location:
Chromosome 8 (position 38581584)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACATCCAACAAATGCTTGACCACCCCATGTTATACACCTTATTTTGTTGG[T/A]AAGCAACCTTTTTGAGTCTCGATTGGAATCATAACACAATGATGCTGACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18024
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000003954 Essential Splice Site 283 397 7 10
Genomic Location:
Chromosome 8 (position 38581929)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGCCAATATGAATTTCCAAATCCCGAGTGGTCGCATGTGTCAGAGGAAGG[T/C]AATTGTATTATATRAACATGTTTGTTCAAKATTGCAAACAATATTACTCA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/ji5bm0oz