midn

Ensembl ID:
ENSDARG00000018524
ZFIN ID:
ZDB-GENE-030131-2433
Description:
Midnolin [Source:UniProtKB/Swiss-Prot;Acc:Q6NYU6]
Human Orthologue:
MIDN
Human Description:
midnolin [Source:HGNC Symbol;Acc:16298]
Mouse Orthologue:
Midn
Mouse Description:
midnolin Gene [Source:MGI Symbol;Acc:MGI:1890222]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa37493 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa37493
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000003929 Essential Splice Site 320 509 5 7
Genomic Location (Zv9):
Chromosome 22 (position 18960522)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 18711457
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CGAAAGTTTTGTGAATCATGCCCCTGGAGTCTTCTCTGGGACATTTTCTG[G/A]TAAATTTTACAAGTTTGATAATTTGTTGATTGACAAATCATATAATCAAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link