pdia4

Ensembl ID:
ENSDARG00000018491
ZFIN ID:
ZDB-GENE-030131-5493
Description:
protein disulfide-isomerase A4 [Source:RefSeq peptide;Acc:NP_956073]
Human Orthologue:
PDIA4
Human Description:
protein disulfide isomerase family A, member 4 [Source:HGNC Symbol;Acc:30167]
Mouse Orthologue:
Pdia4
Mouse Description:
protein disulfide isomerase associated 4 Gene [Source:MGI Symbol;Acc:MGI:104864]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa13170 Nonsense Available for shipment Available now
sa44116 Nonsense Mutation detected in F1 DNA During 2017
sa37857 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa13170
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000018868 Nonsense 98 642 3 10
ENSDART00000081851   None 228 None 4
ENSDART00000018868 Nonsense 98 642 3 10
ENSDART00000081851   None 228 None 4

The following transcripts of ENSDARG00000018491 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 24 (position 17884682)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 17191158
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATATTACACTTTTTCAGGTGTGGCCACTGCAAACAGTTTGCTCCCGAGTA[T/G]GAAAAGATCGCTCAGACGCWGAAGGAAAATGACCYACCTATTCCAGTGGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa44116
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000018868 Nonsense 98 642 3 10
ENSDART00000081851   None 228 None 4
ENSDART00000018868 Nonsense 98 642 3 10
ENSDART00000081851   None 228 None 4

The following transcripts of ENSDARG00000018491 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 24 (position 17884682)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 17191158
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATATTACACTTTTTCAGGTGTGGCCACTGCAAACAGTTTGCTCCCGAGTA[T/A]GAAAAGATCGCTCAGACGCTGAAGGAAAATGACCCACCTATTCCAGTGGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37857
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000018868 Nonsense 206 642 5 10
ENSDART00000081851   None 228 None 4

The following transcripts of ENSDARG00000018491 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 24 (position 17886504)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 17192980
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTAACTTTTTTGAAAGTACTGCGTTTACATTTAAACAGGTGTGGACACTG[T/A]AAGAGACTTGCACCTGAATATGAAAAGGCTGCTAAAGAGCTCAGCAACCG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Height: Hundreds of variants clustered in genomic loci and biological pathways affect human height. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link