cyp2j26

Ensembl ID:
ENSDARG00000018485
ZFIN ID:
ZDB-GENE-040912-139
Description:
cytochrome P450, family 2, subfamily V, polypeptide 2 [Source:RefSeq peptide;Acc:NP_001009890]
Human Orthologue:
CYP2J2
Human Description:
cytochrome P450, family 2, subfamily J, polypeptide 2 [Source:HGNC Symbol;Acc:2634]
Mouse Orthologues:
Cyp2j11-ps, Cyp2j5, Cyp2j6, Cyp2j9
Mouse Descriptions:
cytochrome P450, family 2, subfamily j, polypeptide 11, pseudogene Pseudogene [Source:MGI Symbol;Acc
cytochrome P450, family 2, subfamily j, polypeptide 5 Gene [Source:MGI Symbol;Acc:MGI:1270149]
cytochrome P450, family 2, subfamily j, polypeptide 6 Gene [Source:MGI Symbol;Acc:MGI:1270148]
cytochrome P450, family 2, subfamily j, polypeptide 9 Gene [Source:MGI Symbol;Acc:MGI:1921769]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa29363 Essential Splice Site Mutation detected in F1 DNA During 2016
sa16671 Nonsense Available for shipment Available now
sa37031 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa29363
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000016501 Essential Splice Site 72 505 None 9
ENSDART00000102913 Essential Splice Site 72 504 None 9
ENSDART00000128897   None 479 None 11
Genomic Location (Zv9):
Chromosome 20 (position 25582114)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 25653417
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAATGTTTTCAACCTGGATACTTCACAACCTCATATTGACTTAACTAAGG[T/A]AATTCTTATTTGTTATTACATGTTGTGATTTGATTTCTTAAATATTCGAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16671
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000016501 Nonsense 88 505 2 9
ENSDART00000102913 Nonsense 88 504 2 9
ENSDART00000128897 Nonsense 64 479 3 11
Genomic Location (Zv9):
Chromosome 20 (position 25584321)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 25655624
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCAGATGTCRGACCACTATGGCAACATAWTCAGCTTGCGTCTGGGAAGCY[T/G]AAACACAGTTGTTGTGAACACCTACAGTATGGTGAAGAAAGTTCTTAATG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37031
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000016501 Nonsense 348 505 7 9
ENSDART00000102913 Nonsense 348 504 7 9
ENSDART00000128897 Nonsense 323 479 9 11
Genomic Location (Zv9):
Chromosome 20 (position 25586723)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 25658026
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTATATTCATGTGTACAGAAAAGGTCCAGGCAGAAATAGACAAAGTTGTT[G/T]GACGGTATCGCCGACCCAGCATGGATGACAGACCCTGCATGCCATACACT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link