agxtb

Ensembl ID:
ENSDARG00000018478
ZFIN ID:
ZDB-GENE-010302-3
Description:
alanine-glyoxylate aminotransferase b [Source:RefSeq peptide;Acc:NP_998327]
Human Orthologue:
AGXT
Human Description:
alanine-glyoxylate aminotransferase [Source:HGNC Symbol;Acc:341]
Mouse Orthologue:
Agxt
Mouse Description:
alanine-glyoxylate aminotransferase Gene [Source:MGI Symbol;Acc:MGI:1329033]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa13526 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa13526
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000013863 Nonsense 419 423 11 11

The following transcripts of ENSDARG00000018478 do not overlap with this mutation:

Genomic Location:
Chromosome 2 (position 22134962)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCAATGCTGATAAGGCTCTTGCAGCTCTTGAAGAYGGTTTAAAGCAGTGT[C/T]GAAAAAGCAAAGCCTAAAGACCTGCAATTTTTGCTRTATTTTGTGATGCT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/hpnk9ajr