mbnl2

Ensembl ID:
ENSDARG00000018460
ZFIN ID:
ZDB-GENE-030131-9582
Description:
muscleblind-like 2 isoform A [Source:RefSeq peptide;Acc:NP_001155141]
Human Orthologue:
MBNL2
Human Description:
muscleblind-like 2 (Drosophila) [Source:HGNC Symbol;Acc:16746]
Mouse Orthologue:
Mbnl2
Mouse Description:
muscleblind-like 2 Gene [Source:MGI Symbol;Acc:MGI:2145597]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa32578 Essential Splice Site Mutation detected in F1 DNA During 2016
sa9005 Nonsense Mutation detected in F1 DNA During 2016
sa19403 Essential Splice Site Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa32578
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000022019 Essential Splice Site 58 339 1 7
ENSDART00000043864 Essential Splice Site 58 371 1 8
ENSDART00000074923   None 208 None 6
ENSDART00000098059   None 208 None 6
ENSDART00000122626 Essential Splice Site 58 383 1 9
ENSDART00000124534 Essential Splice Site 58 371 1 8
ENSDART00000128187   58 58 2 2
ENSDART00000131714   None 9 None 2
ENSDART00000132126   None 169 None 4
ENSDART00000138396   None 9 None 2

The following transcripts of ENSDARG00000018460 do not overlap with this mutation:

Genomic Location:
Chromosome 1 (position 1886418)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCTGCCAGGTGGAGAACGGACGGGTGATCGCCTGCTTCGACTCGCTGAAG[G/A]TAAGAGTGGCAGATTATTTGGTGCAGATTTCCTTTAGCTAATCCCAAAGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9005
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000022019 Nonsense 299 339 5 7
ENSDART00000043864 Nonsense 317 371 6 8
ENSDART00000074923 Nonsense 154 208 4 6
ENSDART00000098059 Nonsense 154 208 4 6
ENSDART00000122626 Nonsense 317 383 6 9
ENSDART00000124534 Nonsense 317 371 6 8
ENSDART00000128187   None 58 None 2
ENSDART00000131714   None 9 None 2
ENSDART00000132126 Nonsense 115 169 2 4
ENSDART00000138396   None 9 None 2

The following transcripts of ENSDARG00000018460 do not overlap with this mutation:

Genomic Location:
Chromosome 1 (position 1958345)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAAAGAGTAACGGGGCCAGCACGCTCTTCAACCCCAGTGTCTTGCACTAC[C/T]AAMAGGCTTTGGCCARCGCACAGCTTCAGCAGCCCACCGCTGCGTTCTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19403
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000022019 Essential Splice Site 336 339 None 7
ENSDART00000043864 Essential Splice Site 368 371 None 8
ENSDART00000074923 Essential Splice Site 205 208 None 6
ENSDART00000098059 Essential Splice Site 205 208 None 6
ENSDART00000122626 Essential Splice Site 380 383 None 9
ENSDART00000124534 Essential Splice Site 368 371 None 8
ENSDART00000128187   None 58 None 2
ENSDART00000131714   None 9 None 2
ENSDART00000132126 Essential Splice Site 166 169 None 4
ENSDART00000138396   None 9 None 2

The following transcripts of ENSDARG00000018460 do not overlap with this mutation:

Genomic Location:
Chromosome 1 (position 1970965)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACCTTCACTAATATCAGGATGCTGTTCTGTGTTTGTTTGTTTGTTTGTGC[A/T]GATCATCTTGAAGTAAATCACCGAAGAGGAACGGGGTGTCAGGAAGCTGC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link