mbnl2

Ensembl ID:
ENSDARG00000018460
ZFIN ID:
ZDB-GENE-030131-9582
Description:
muscleblind-like 2 isoform A [Source:RefSeq peptide;Acc:NP_001155141]
Human Orthologue:
MBNL2
Human Description:
muscleblind-like 2 (Drosophila) [Source:HGNC Symbol;Acc:16746]
Mouse Orthologue:
Mbnl2
Mouse Description:
muscleblind-like 2 Gene [Source:MGI Symbol;Acc:MGI:2145597]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa9005 Nonsense Mutation detected in F1 DNA During 2014
sa19403 Essential Splice Site Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa9005
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000022019 Nonsense 299 339 5 7
ENSDART00000043864 Nonsense 317 371 6 8
ENSDART00000074923 Nonsense 154 208 4 6
ENSDART00000098059 Nonsense 154 208 4 6
ENSDART00000122626 Nonsense 317 383 6 9
ENSDART00000124534 Nonsense 317 371 6 8
ENSDART00000128187 None None 58 None 2
ENSDART00000131714 None None 9 None 2
ENSDART00000132126 Nonsense 115 169 2 4
ENSDART00000138396 None None 9 None 2

The following transcripts of ENSDARG00000018460 do not overlap with this mutation:

Genomic Location:
Chromosome 1 (position 1958345)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAAAGAGTAACGGGGCCAGCACGCTCTTCAACCCCAGTGTCTTGCACTAC[C/T]AAMAGGCTTTGGCCARCGCACAGCTTCAGCAGCCCACCGCTGCGTTCTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19403
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000022019 Essential Splice Site 336 339 None 7
ENSDART00000043864 Essential Splice Site 368 371 None 8
ENSDART00000074923 Essential Splice Site 205 208 None 6
ENSDART00000098059 Essential Splice Site 205 208 None 6
ENSDART00000122626 Essential Splice Site 380 383 None 9
ENSDART00000124534 Essential Splice Site 368 371 None 8
ENSDART00000128187 None None 58 None 2
ENSDART00000131714 None None 9 None 2
ENSDART00000132126 Essential Splice Site 166 169 None 4
ENSDART00000138396 None None 9 None 2

The following transcripts of ENSDARG00000018460 do not overlap with this mutation:

Genomic Location:
Chromosome 1 (position 1970965)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACCTTCACTAATATCAGGATGCTGTTCTGTGTTTGTTTGTTTGTTTGTGC[A/T]GATCATCTTGAAGTAAATCACCGAAGAGGAACGGGGTGTCAGGAAGCTGC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/zwi58t3x