heg

Ensembl ID:
ENSDARG00000018441
ZFIN ID:
ZDB-GENE-040714-1
Description:
Protein HEG [Source:UniProtKB/Swiss-Prot;Acc:Q6R8J2]
Human Orthologue:
HEG1
Human Description:
HEG homolog 1 (zebrafish) [Source:HGNC Symbol;Acc:29227]
Mouse Orthologue:
Heg1
Mouse Description:
HEG homolog 1 (zebrafish) Gene [Source:MGI Symbol;Acc:MGI:1924696]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa14693 Nonsense Available for shipment Available now
sa14122 Nonsense Available for shipment Available now
sa41490 Nonsense Mutation detected in F1 DNA During 2016
sa41491 Essential Splice Site Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa14693
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000004462 Nonsense 95 977 2 13
ENSDART00000140325 Nonsense 95 841 2 12
ENSDART00000147938 Nonsense 95 935 2 11
Genomic Location (Zv9):
Chromosome 9 (position 39744537)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 38882433
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AACTCGTTCTTCTTTAAYTATCCAATMCAGGACATTCACCAAAACCTTTA[C/T]AAACCTCTACAAATGCAGCGGATTGGAAGACCAGTATGACCTCAGATGAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14122
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000004462 Nonsense 671 977 5 13
ENSDART00000140325 Nonsense 671 841 5 12
ENSDART00000147938 Nonsense 671 935 5 11
Genomic Location (Zv9):
Chromosome 9 (position 39748890)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 38886786
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CATAAGATAACTCTGTCTGCTTTGGTTTTACCTTGCAGTCAAGACATTTT[T/A]GGGCACTTTCACAGTCAACAACTCTCTTCATCTCAGAAATTTAGGTCTGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41490
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000004462 Nonsense 781 977 8 13
ENSDART00000140325 Nonsense 781 841 8 12
ENSDART00000147938 Nonsense 781 935 8 11
Genomic Location (Zv9):
Chromosome 9 (position 39752416)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 38890312
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACCTCTTTCTGTTTAGTGGAGAGCCTGTGCATGGCCCAGAAGACCAAGTG[T/A]GATGTGCAGTACTCAGATTGCTCGGATATTAGCGGGATTCCCAACTGTCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41491
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000004462 Essential Splice Site 829 977 9 13
ENSDART00000140325 Essential Splice Site 829 841 9 12
ENSDART00000147938 Essential Splice Site 829 935 9 11
Genomic Location (Zv9):
Chromosome 9 (position 39752650)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 38890546
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTTTAGACTGTGGAGATGGACTCAAGCTTGTTAATGGCAAATGTGTCGAG[T/A]AAGTATATTGTTTATTAATGCGTAAACAGCCGCTCAGATGTTTGGCAATA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link