heg

Ensembl ID:
ENSDARG00000018441
ZFIN ID:
ZDB-GENE-040714-1
Description:
Protein HEG [Source:UniProtKB/Swiss-Prot;Acc:Q6R8J2]
Human Orthologue:
HEG1
Human Description:
HEG homolog 1 (zebrafish) [Source:HGNC Symbol;Acc:29227]
Mouse Orthologue:
Heg1
Mouse Description:
HEG homolog 1 (zebrafish) Gene [Source:MGI Symbol;Acc:MGI:1924696]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa14693 Nonsense Available for shipment Available now
sa14122 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa14693
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000004462 Nonsense 95 977 2 13
ENSDART00000140325 Nonsense 95 841 2 12
ENSDART00000147938 Nonsense 95 935 2 11
Genomic Location:
Chromosome 9 (position 39744537)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AACTCGTTCTTCTTTAAYTATCCAATMCAGGACATTCACCAAAACCTTTA[C/T]AAACCTCTACAAATGCAGCGGATTGGAAGACCAGTATGACCTCAGATGAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14122
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000004462 Nonsense 671 977 5 13
ENSDART00000140325 Nonsense 671 841 5 12
ENSDART00000147938 Nonsense 671 935 5 11
Genomic Location:
Chromosome 9 (position 39748890)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CATAAGATAACTCTGTCTGCTTTGGTTTTACCTTGCAGTCAAGACATTTT[T/A]GGGCACTTTCACAGTCAACAACTCTCTTCATCTCAGAAATTTAGGTCTGC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/nvqu358m