m6pr

Ensembl ID:
ENSDARG00000018432
ZFIN ID:
ZDB-GENE-040426-2285
Description:
cation-dependent mannose-6-phosphate receptor [Source:RefSeq peptide;Acc:NP_998370]
Human Orthologue:
M6PR
Human Description:
mannose-6-phosphate receptor (cation dependent) [Source:HGNC Symbol;Acc:6752]
Mouse Orthologue:
M6pr
Mouse Description:
mannose-6-phosphate receptor, cation dependent Gene [Source:MGI Symbol;Acc:MGI:96904]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa42695 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa42695
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000017142 Nonsense 94 265 3 7
ENSDART00000128974 Nonsense 94 265 2 6
ENSDART00000138306 Nonsense 94 179 2 4
Genomic Location (Zv9):
Chromosome 16 (position 19647370)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 17677693
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGTCTTATTCAGCAAGAAAAAGGTGGAAAGACGATTCGAATTGGGGACTA[C/A]AGTAAAACAGTTGCCACTGCAGGAAGTATGTTATACTTCTAGTCTTTCAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link