klhl12

Ensembl ID:
ENSDARG00000018430
ZFIN ID:
ZDB-GENE-041114-205
Description:
Kelch-like protein 12 [Source:UniProtKB/Swiss-Prot;Acc:Q5U374]
Human Orthologue:
KLHL12
Human Description:
kelch-like 12 (Drosophila) [Source:HGNC Symbol;Acc:19360]
Mouse Orthologue:
Klhl12
Mouse Description:
kelch-like 12 (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:2385619]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa1918 Essential Splice Site F2 line generated During 2017
sa38696 Nonsense Mutation detected in F1 DNA During 2017
sa31659 Nonsense Available for shipment Available now
sa21315 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa1918
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000043815 Essential Splice Site 112 564 3 12
Genomic Location (Zv9):
Chromosome 8 (position 29217856)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 28385018
KASP Assay ID:
554-1907.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGAAAACGTCCAGGAGCTGCTGCCCGCTGCCTGTCTCCTGCAGCTTAAAG[G/A]TACAGGAACACAAATCAGCCTAGACCATGTATATTTCTNNGTCATTAGGTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38696
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000043815 Nonsense 245 564 6 12
Genomic Location (Zv9):
Chromosome 8 (position 29212643)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 28390231
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGTGTTGTTTTGATGTGTTTCAGCCGTTGATACGCTGTAGTCTGCCTTGC[C/T]GAGATTTGGTGGATGAAGCAAAGAAGTTTCATCTTCGTCCAGAGTTACGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31659
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000043815 Nonsense 298 564 7 12
Genomic Location (Zv9):
Chromosome 8 (position 29210862)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 28392012
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATCGGAGGATTTGGCAGCCAGCAGTCTCCTATTGATATTGTCGAGAAGTA[C/A]GATCCCAAAACCCGAGAGTGGAGCTTTCTTCCAGTGAGTGTTGTCCTCTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21315
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000043815 Nonsense 543 564 12 12
Genomic Location (Zv9):
Chromosome 8 (position 29204838)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 28332610
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AACTCACTGCTCAGCAGCATTGAATGTTACGACCCCGTGATTGACAGCTG[G/A]GAAGTGGTGACGTCAATGGCAACACAACGCTGTGACGCAGGCGTTTGTGT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link