aldh7a1

Ensembl ID:
ENSDARG00000018426
ZFIN ID:
ZDB-GENE-030131-6129
Description:
alpha-aminoadipic semialdehyde dehydrogenase [Source:RefSeq peptide;Acc:NP_997889]
Human Orthologue:
ALDH7A1
Human Description:
aldehyde dehydrogenase 7 family, member A1 [Source:HGNC Symbol;Acc:877]
Mouse Orthologue:
Aldh7a1
Mouse Description:
aldehyde dehydrogenase family 7, member A1 Gene [Source:MGI Symbol;Acc:MGI:108186]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa1371 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa1371
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000122540 Essential Splice Site 293 541 9 18
Genomic Location:
Chromosome 10 (position 16045925)
KASP Assay ID:
554-1283.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGCACTCATGTGGGCAAACAAGTGGCAATGATGGTACAAGAACGGTTTGG[T/C]GAGTTTTATGCATTACAATAGAATTTAATCGCAGTCTGTCATAATGTTTT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Osteoporosis: Genome-wide association study identifies ALDH7A1 as a novel susceptibility gene for osteoporosis. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/rbmvc6ht