aldh7a1

Ensembl ID:
ENSDARG00000018426
ZFIN ID:
ZDB-GENE-030131-6129
Description:
alpha-aminoadipic semialdehyde dehydrogenase [Source:RefSeq peptide;Acc:NP_997889]
Human Orthologue:
ALDH7A1
Human Description:
aldehyde dehydrogenase 7 family, member A1 [Source:HGNC Symbol;Acc:877]
Mouse Orthologue:
Aldh7a1
Mouse Description:
aldehyde dehydrogenase family 7, member A1 Gene [Source:MGI Symbol;Acc:MGI:108186]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa45400 Nonsense Mutation detected in F1 DNA During 2018
sa1371 Essential Splice Site Available for shipment Available now
sa41611 Essential Splice Site Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa45400
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000122540 Nonsense 118 541 4 18
Genomic Location (Zv9):
Chromosome 10 (position 16048649)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 16061956
GRCz11 10 16020075
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGCTATGTGTTATTTAGGTACCTGCTCCAAAGAGAGGGGAAATTGTTCGA[C/T]AGATTGGAGAGGCTTTAAGGAGGAAGATCAAAGCTCTCGGCAGCTTAGTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1371
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000122540 Essential Splice Site 293 541 9 18
Genomic Location (Zv9):
Chromosome 10 (position 16045925)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 16059232
GRCz11 10 16017351
KASP Assay ID:
554-1283.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGCACTCATGTGGGCAAACAAGTGGCAATGATGGTACAAGAACGGTTTGG[T/C]GAGTTTTATGCATTACAATAGAATTTAATCGCAGTCTGTCATAATGTTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41611
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000122540 Essential Splice Site 498 541 16 18
Genomic Location (Zv9):
Chromosome 10 (position 16038489)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 16051796
GRCz11 10 16009915
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGTGAACGTTAACATTCCTACTAGCGGTGCTGAGATTGGAGGAGCGTTTG[G/A]TGCGTATATTATACACCACACCATTCTAAAATTAACTAACTAAACTTACA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Osteoporosis: Genome-wide association study identifies ALDH7A1 as a novel susceptibility gene for osteoporosis. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link