pth1rb

Ensembl ID:
ENSDARG00000018418
ZFIN ID:
ZDB-GENE-991123-12
Description:
parathyroid hormone 1 receptor b [Source:RefSeq peptide;Acc:NP_571453]
Human Orthologue:
PTH1R
Human Description:
parathyroid hormone 1 receptor [Source:HGNC Symbol;Acc:9608]
Mouse Orthologue:
Pth1r
Mouse Description:
parathyroid hormone 1 receptor Gene [Source:MGI Symbol;Acc:MGI:97801]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa17271 Nonsense Available for shipment Available now
sa22039 Nonsense Available for shipment Available now
sa22038 Essential Splice Site Available for shipment Available now
sa41969 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa17271
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000003805 Nonsense 57 542 3 14
ENSDART00000123989 Nonsense 57 542 2 13
Genomic Location (Zv9):
Chromosome 12 (position 10036296)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 9244251
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTGCGCGGTCRAGGTGTGAGAGAACCATCCGTGCACAGTCAGACGTGGTC[A/T]GAGGTATAACARTGTATTTMTATTTTATTTCAGCRCTATTTAYTGTATAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22039
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000003805 Nonsense 96 542 5 14
ENSDART00000123989 Nonsense 96 542 4 13
Genomic Location (Zv9):
Chromosome 12 (position 10029821)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 9237776
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCAGTTCATGTGGACTTTAAATATTAAGTATTTCTGTTTATTTTAGGATA[C/A]GCGTATCGACACTGTGATGCATCAGGTAACTGGGAGCAGGTGTCCATTAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22038
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000003805 Essential Splice Site 167 542 7 14
ENSDART00000123989 Essential Splice Site 167 542 6 13
Genomic Location (Zv9):
Chromosome 12 (position 10023023)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 9230978
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CACCTATACAAGTCAACCACATTTTTCTCTCTTCTGTATTTTCTTTCTCT[A/T]GACGTCTCCACTGCACTCGTAACTACATCCACATCCACCTCTTCACCTCG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41969
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000003805 Essential Splice Site 269 542 8 14
ENSDART00000123989 Essential Splice Site 269 542 7 13
Genomic Location (Zv9):
Chromosome 12 (position 10022622)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 9230577
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTCCTGTCTGATAAGAACTGCCTGTGGGCTTTAACAATCATAGGCTGGGG[T/C]GAGCTGGCACTTTTTGTTTTGCAGATAGCTGTTGATAGTAATATTTGTGA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link