mknk1

Ensembl ID:
ENSDARG00000018411
ZFIN IDs:
ZDB-GENE-080220-11, ZDB-GENE-080220-11
Description:
MAP kinase-interacting serine/threonine-protein kinase 1 [Source:RefSeq peptide;Acc:NP_001108211]
Human Orthologue:
MKNK1
Human Description:
MAP kinase interacting serine/threonine kinase 1 [Source:HGNC Symbol;Acc:7110]
Mouse Orthologue:
Mknk1
Mouse Description:
MAP kinase-interacting serine/threonine kinase 1 Gene [Source:MGI Symbol;Acc:MGI:894316]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa41797 Nonsense Mutation detected in F1 DNA During 2016
sa14337 Nonsense Available for shipment Available now
sa6198 Nonsense Mutation detected in F1 DNA During 2016
sa35046 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa41797
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000123257 Nonsense 78 461 4 15
ENSDART00000125371 Nonsense 76 459 4 14
Genomic Location (Zv9):
Chromosome 11 (position 13366941)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 13123764
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TAGGAATGGAGAGCAGTCAACCAATCAGCATCACAGACCCAAGTTCACGC[C/T]GAAAGAAGAAACGCAGAAGAGCCGGAGACAGTTTCACAGGCAAATTTTGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14337
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000123257 Nonsense 109 461 5 15
ENSDART00000125371 Nonsense 107 459 5 14
Genomic Location (Zv9):
Chromosome 11 (position 13367226)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 13124049
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTTTTAGATCTATACAGGCTGACGGATGAGCTGCTGGGTCAGGGAGCTTA[T/A]GCCAAAGTCCAGGGCTGTGTGAGTTTACAAAATGGCACRGAGTATGCGGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6198
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000123257 Nonsense 188 461 8 15
ENSDART00000125371 Nonsense 186 459 8 14
Genomic Location (Zv9):
Chromosome 11 (position 13368354)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 13125177
KASP Assay ID:
554-5139.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAATATTTTCTKTTGTCCTCCTAGGTTCCATTTTGACACACATCCAGAGT[C/T]GAAAATACTTYGAYGAGAGAGAAGCGAGTCGTGTGGTCAGGGATATAGCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35046
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000123257 Nonsense 423 461 14 15
ENSDART00000125371 Nonsense 421 459 14 14
Genomic Location (Zv9):
Chromosome 11 (position 13373956)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 13130779
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGACGCAGTTTGCAGCTGAAGCCATCGCGTTTAACCGGCAGCTGTCGCAA[C/T]AGGAAGAAGAGCAGGAAGACTTTGGCGCTGTCGTCTGCTCCATGAGGCTT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link