mknk1

Ensembl ID:
ENSDARG00000018411
ZFIN IDs:
ZDB-GENE-080220-11, ZDB-GENE-080220-11
Description:
MAP kinase-interacting serine/threonine-protein kinase 1 [Source:RefSeq peptide;Acc:NP_001108211]
Human Orthologue:
MKNK1
Human Description:
MAP kinase interacting serine/threonine kinase 1 [Source:HGNC Symbol;Acc:7110]
Mouse Orthologue:
Mknk1
Mouse Description:
MAP kinase-interacting serine/threonine kinase 1 Gene [Source:MGI Symbol;Acc:MGI:894316]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa14337 Nonsense Available for shipment Available now
sa6198 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa14337
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000123257 Nonsense 109 461 5 15
ENSDART00000125371 Nonsense 107 459 5 14
Genomic Location:
Chromosome 11 (position 13367226)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTTTTAGATCTATACAGGCTGACGGATGAGCTGCTGGGTCAGGGAGCTTA[T/A]GCCAAAGTCCAGGGCTGTGTGAGTTTACAAAATGGCACRGAGTATGCGGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6198
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000123257 Nonsense 188 461 8 15
ENSDART00000125371 Nonsense 186 459 8 14
Genomic Location:
Chromosome 11 (position 13368354)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAATATTTTCTKTTGTCCTCCTAGGTTCCATTTTGACACACATCCAGAGT[C/T]GAAAATACTTYGAYGAGAGAGAAGCGAGTCGTGTGGTCAGGGATATAGCA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/qf43xojv