krt18

Ensembl ID:
ENSDARG00000018404
ZFIN ID:
ZDB-GENE-030411-6
Description:
Keratin, type I cytoskeletal 18 [Source:UniProtKB/Swiss-Prot;Acc:Q7ZTS4]
Human Orthologues:
AC090051.1, KRT18
Human Descriptions:
keratin 18 [Source:HGNC Symbol;Acc:6430]
Uncharacterized protein [Source:UniProtKB/TrEMBL;Acc:C9JEA8]
Mouse Orthologue:
Krt18
Mouse Description:
keratin 18 Gene [Source:MGI Symbol;Acc:MGI:96692]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa24263 Nonsense Available for shipment Available now
sa37630 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa24263
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000020750 Nonsense 247 460 3 7
ENSDART00000127667 Nonsense 218 431 3 7

The following transcripts of ENSDARG00000018404 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 23 (position 10456611)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 10415413
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGAACCTTGAGAGCGAGATCGAGGCCCTCAAAGAAGAGCTCATCTTCCTT[A/T]AGAAGAACCATGACAATGTGAGTACACATCTGGCACATCTGGAAACATTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37630
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000020750 Essential Splice Site 252 460 3 7
ENSDART00000127667 Essential Splice Site 223 431 3 7

The following transcripts of ENSDARG00000018404 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 23 (position 10456629)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 10415431
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCGAGGCCCTCAAAGAAGAGCTCATCTTCCTTAAGAAGAACCATGACAAT[G/T]TGAGTACACATCTGGCACATCTGGAAACATTTGTCCACCTCGTAATTCGT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link