hpca

Ensembl ID:
ENSDARG00000018397
ZFIN ID:
ZDB-GENE-040426-1683
Description:
neuron-specific calcium-binding protein hippocalcin [Source:RefSeq peptide;Acc:NP_957017]
Human Orthologue:
HPCA
Human Description:
hippocalcin [Source:HGNC Symbol;Acc:5144]
Mouse Orthologue:
Hpca
Mouse Description:
hippocalcin Gene [Source:MGI Symbol;Acc:MGI:1336200]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa1437 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa1437
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000004034 Nonsense 66 193 3 5

The following transcripts of ENSDARG00000018397 do not overlap with this mutation:

Genomic Location:
Chromosome 19 (position 34013708)
KASP Assay ID:
554-1364.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGAAGATCTATGCCAACTTCTTCCCGTATGGTGACGCCTCGAAGTTCGCA[G/T]AGCATGTCTTCCGTACATTTGACACCAACAAYGACGGCACCATCGATTTC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/0fqwb710