si:busm1-118j2.12

Ensembl ID:
ENSDARG00000018393
ZFIN ID:
ZDB-GENE-040724-121
Description:
Novel protein [Source:UniProtKB/TrEMBL;Acc:Q7SZV7]
Human Orthologue:
KANK2
Human Description:
KN motif and ankyrin repeat domains 2 [Source:HGNC Symbol;Acc:29300]
Mouse Orthologue:
Kank2
Mouse Description:
KN motif and ankyrin repeat domains 2 Gene [Source:MGI Symbol;Acc:MGI:2384568]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa20153 Essential Splice Site Mutation detected in F1 DNA During 2017
sa33329 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa20153
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000022432 Essential Splice Site 422 862 5 15
Genomic Location (Zv9):
Chromosome 3 (position 56028407)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 54922133
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTTACAGTGGTATTCTGCTTTTTTGGTACCTTTTGGTATCACAGAAAGAG[G/A]TCATACTAACATGAGGGTGAGAGAACTGACTATTTTCAGTGCTAATTTAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33329
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000022432 Nonsense 558 862 8 15
Genomic Location (Zv9):
Chromosome 3 (position 56026887)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 54920613
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAAGCGAATACCATGAGGCTACGGAAAAACTACCGGAATCAGCGACACCA[C/T]AGTCTCTGGTGTCCTCCTGTATCCCACAGCTCGCCTCTGAGACACCAGCT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link