im:7162965

Ensembl ID:
ENSDARG00000018345
ZFIN ID:
ZDB-GENE-060810-178
Human Orthologue:
DAPK2
Human Description:
death-associated protein kinase 2 [Source:HGNC Symbol;Acc:2675]
Mouse Orthologue:
Dapk2
Mouse Description:
death-associated protein kinase 2 Gene [Source:MGI Symbol;Acc:MGI:1341297]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa4574 Essential Splice Site Mutation detected in F1 DNA During 2014
sa6353 Essential Splice Site Mutation detected in F1 DNA During 2014
sa9556 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa4574
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000008904 Essential Splice Site 100 368 2 11
Genomic Location:
Chromosome 14 (position 47313454)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATGCATGACCTTTATGAGAACCGCACTGATGTGACGCTTGTCCTGGAGCT[G/T]TAAGTCAGAATACATMCTCCCACATTTATGAAAAGTTAGAATTATTCATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6353
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000008904 Essential Splice Site 281 368 8 11
Genomic Location:
Chromosome 14 (position 47394760)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCAGAAAAAGGCTTAAAATACAAGATGCACTCAACCACCCCTGGATTAAG[G/A]TACTAAATCTGCACATTTAGAAACATGCCCTATTAAAWACAATGTTATTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9556
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000008904 Nonsense 310 368 9 11
Genomic Location:
Chromosome 14 (position 47409060)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCTGTGGTGAACCTTGAGAACTKCAAGAGACAGTATGCCCGAAGGAGGTG[G/A]CAGGTAGGAGTTTGTCATTAAATTTTTTATCAAATTTTATCAAATATATA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/zo3mfax6