LOC569014

Ensembl ID:
ENSDARG00000018342
Human Orthologues:
GGT1, GGT2, GGTLC1, GGTLC2, GGTLC3
Human Descriptions:
gamma-glutamyltransferase 1 [Source:HGNC Symbol;Acc:4250]
gamma-glutamyltransferase 2 [Source:HGNC Symbol;Acc:4251]
gamma-glutamyltransferase light chain 1 [Source:HGNC Symbol;Acc:16437]
gamma-glutamyltransferase light chain 2 [Source:HGNC Symbol;Acc:18596]
gamma-glutamyltransferase light chain 3 [Source:HGNC Symbol;Acc:33426]
Mouse Orthologue:
Ggt1
Mouse Description:
gamma-glutamyltransferase 1 Gene [Source:MGI Symbol;Acc:MGI:95706]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa7653 Essential Splice Site Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa7653
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000042915 Essential Splice Site 300 574 6 12
Genomic Location:
Chromosome 10 (position 43007919)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCTCCGTCCAGCGGTCCAGTGCTTACACTCATGCTGAAYATCCTCAGTGG[T/C]GCGTACRGTACACACTTCAACACTACACTATATCCTGCAGATGTTTATGC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/mi6oytyc