gc2

Ensembl ID:
ENSDARG00000018329
ZFIN ID:
ZDB-GENE-011128-8
Description:
guanylyl cyclase 2 [Source:RefSeq peptide;Acc:NP_001103165]
Human Orthologue:
GUCY2F
Human Description:
guanylate cyclase 2F, retinal [Source:HGNC Symbol;Acc:4691]
Mouse Orthologue:
Gucy2f
Mouse Description:
guanylate cyclase 2f Gene [Source:MGI Symbol;Acc:MGI:105119]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa34182 Nonsense Mutation detected in F1 DNA During 2017
sa41018 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa34182
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000098648 Nonsense 330 1107 2 18
ENSDART00000098649 Nonsense 322 1099 3 19
ENSDART00000125807   None 259 None 7
Genomic Location (Zv9):
Chromosome 7 (position 52746023)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 51015773
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GATGCTGTGCTCACGATCACTATTGAGTCTCCAAAGGAACAGTCTTTTTA[T/A]CAAGCTTTTGAAAAGGCACAGGAGGATGGAGAGTTACCCAAACACCTCAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41018
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000098648 Essential Splice Site 350 1107 2 18
ENSDART00000098649 Essential Splice Site 342 1099 3 19
ENSDART00000125807   None 259 None 7
Genomic Location (Zv9):
Chromosome 7 (position 52745961)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 51015711
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAAGGCACAGGAGGATGGAGAGTTACCCAAACACCTCAAACCACAGCAGG[T/C]ACAAAGACTGTTTACATATGGCGTTACTTTTTTTGTACTAAGTTAATGGC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link