rhoad

Ensembl ID:
ENSDARG00000018328
ZFIN ID:
ZDB-GENE-040718-144
Description:
ras homolog gene family, member Ad [Source:RefSeq peptide;Acc:NP_001002445]
Human Orthologue:
RHOC
Human Description:
ras homolog gene family, member C [Source:HGNC Symbol;Acc:669]
Mouse Orthologues:
4930544G11Rik, Rhoc
Mouse Descriptions:
ras homolog gene family, member C Gene [Source:MGI Symbol;Acc:MGI:106028]
RIKEN cDNA 4930544G11 gene Gene [Source:MGI Symbol;Acc:MGI:1914903]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa27222 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa27222
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000016696 Nonsense 51 193 2 5
ENSDART00000135568 Nonsense 51 94 2 5
Genomic Location (Zv9):
Chromosome 8 (position 28468024)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 27595942
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACGTGCCCACAGTGTTCGAAAACTACATTGCTGACATAGAAGTGGACAGC[A/T]AACAGGTGGGTTGTTATTATACTGTGCTGGACACGTTCTTCCTTTTTTTG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link