lbx1a

Ensembl ID:
ENSDARG00000018321
ZFIN ID:
ZDB-GENE-040724-40
Description:
transcription factor LBX1 [Source:RefSeq peptide;Acc:NP_001020703]
Human Orthologue:
LBX1
Human Description:
ladybird homeobox 1 [Source:HGNC Symbol;Acc:16960]
Mouse Orthologue:
Lbx1
Mouse Description:
ladybird homeobox homolog 1 (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:104867]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa1496 Nonsense Available for shipment Available now
hu3569 Nonsense Confirmed mutation in F2 line Unknown

Mutation Details

Allele Name:
sa1496
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000045351 Nonsense 136 269 2 2
Genomic Location:
Chromosome 13 (position 28529941)
KASP Assay ID:
554-1421.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGAATACCCCTAAAAAACGGAGAAAGTCGAGAACAGCTTTCACCAATCAC[C/T]AAATCTACGAACTTGAGAAGAGATTTCTCTATCAGAAATATCTGTCTCCG
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Mutation Details

Allele Name:
hu3569
Current Status:
Confirmed mutation in F2 line
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Unknown
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000045351 Nonsense 174 269 2 2
Genomic Location:
Chromosome 13 (position 28529827)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGATCGCTCAGCAGCTCGGGCTCACGAATGCTCAAGTCATCACCTGGTTC[C/T]AGAATCGCCGAGCCAAACTCAAAAGAGACCTAGAGGAGATGAAGGCGGAC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Scoliosis: A genome-wide association study identifies common variants near LBX1 associated with adolescent idiopathic scoliosis. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/rvtf4wwx