pea3

Ensembl ID:
ENSDARG00000018303
ZFIN ID:
ZDB-GENE-990415-71
Description:
ETS translocation variant 4 [Source:UniProtKB/Swiss-Prot;Acc:Q9PUQ1]
Human Orthologue:
ETV4
Human Description:
ets variant 4 [Source:HGNC Symbol;Acc:3493]
Mouse Orthologue:
Etv4
Mouse Description:
ets variant gene 4 (E1A enhancer binding protein, E1AF) Gene [Source:MGI Symbol;Acc:MGI:99423]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
hu3536 Nonsense Confirmed mutation in F2 line Unknown
sa45463 Essential Splice Site Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
hu3536
Current Status:
Confirmed mutation in F2 line
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Unknown
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000013033 Nonsense 169 494 6 12
ENSDART00000136212 Nonsense 120 263 4 6

The following transcripts of ENSDARG00000018303 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 12 (position 29129713)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 27467322
GRCz11 12 27558682
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCCTATGCAGCATTATTCCCCCAAACCAACAGTGGGAACTCGGCAGGAAT[C/A]AGGGTATATGAATCCACCCTCAGCCAGCCAATCCCACGCCTGCCACAGCC
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Mutation Details

Allele Name:
sa45463
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000013033 Essential Splice Site 311 494 8 12
ENSDART00000136212   263 263 6 6

The following transcripts of ENSDARG00000018303 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 12 (position 29134525)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 27472134
GRCz11 12 27563494
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CATGTACCATCACAACGAAGGCTACTCCAACCCACAGCACAACAGTGAAG[G/T]TAAGAGCACCATTTGTCCATCTACAACATGCAGCTCCAGTGCAGTTCTAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link